Incidental Mutation 'R7323:Gm11639'
ID568304
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Namepredicted gene 11639
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7323 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location104685707-105117394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105030011 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 4676 (L4676P)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000212287
AA Change: L4676P

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik C A 5: 99,979,086 A9E unknown Het
6030452D12Rik A T 8: 106,500,779 probably null Het
Abcb11 C A 2: 69,287,635 Q466H probably damaging Het
Adam20 A G 8: 40,795,384 D177G probably benign Het
Ampd1 A T 3: 103,085,380 Q150L probably benign Het
Angpt2 A C 8: 18,705,824 M209R probably benign Het
Aoc2 G A 11: 101,328,545 R598Q probably damaging Het
Arap1 A G 7: 101,400,211 D960G probably damaging Het
Bhlhe40 G C 6: 108,665,281 L395F probably benign Het
Cacna1i T C 15: 80,391,653 C1882R possibly damaging Het
Ccr6 A G 17: 8,256,779 N272S possibly damaging Het
Ces1f A T 8: 93,271,844 W175R probably damaging Het
Ces3a A C 8: 105,055,607 H364P possibly damaging Het
Cfap54 T C 10: 92,801,138 M3130V probably benign Het
Clca3b G A 3: 144,825,920 P708S possibly damaging Het
Cps1 A T 1: 67,157,869 T360S probably benign Het
Cramp1l A T 17: 24,982,405 M701K possibly damaging Het
Dnah1 A G 14: 31,298,707 I1235T probably damaging Het
Ergic1 A G 17: 26,641,670 E244G probably damaging Het
Fignl2 C A 15: 101,053,501 R300L unknown Het
Fry T C 5: 150,496,349 M628T Het
Fscn3 A G 6: 28,431,545 T292A possibly damaging Het
Fsip2 A T 2: 82,989,516 I5198L probably benign Het
Gm4181 T A 14: 51,632,533 R104W probably damaging Het
Gnl1 G A 17: 35,983,413 R308H probably benign Het
Gtf2h4 G T 17: 35,669,965 L271I probably damaging Het
Helq GTTT GTT 5: 100,783,185 probably null Het
Hhatl A T 9: 121,789,586 W117R probably benign Het
Hlx A G 1: 184,730,796 F220L probably benign Het
Il31ra T C 13: 112,551,963 I27V probably damaging Het
Itga8 T G 2: 12,262,129 D165A probably damaging Het
Krt33a A C 11: 100,011,975 V341G probably benign Het
Lrrc3c A G 11: 98,599,440 M208V possibly damaging Het
Mapk8ip3 A T 17: 24,901,161 S947T probably benign Het
Muc5b A G 7: 141,858,707 I1797V unknown Het
Myh2 A T 11: 67,197,365 T1936S probably benign Het
Nr1h2 T C 7: 44,550,322 Y391C possibly damaging Het
Olfr1168 A G 2: 88,185,608 T244A possibly damaging Het
Olfr1219 A T 2: 89,074,467 I208K probably damaging Het
Olfr1509 A G 14: 52,451,213 I267V probably benign Het
Olfr355 T A 2: 36,927,974 I47F probably damaging Het
Phf3 A G 1: 30,813,130 M1064T probably benign Het
Pkd1 A G 17: 24,575,051 E1904G probably benign Het
Polrmt A G 10: 79,740,649 V491A probably benign Het
Ppm1j C A 3: 104,784,113 R306S probably damaging Het
Prkd2 T C 7: 16,847,622 F134S probably benign Het
Prpf8 C A 11: 75,491,784 Q439K probably benign Het
Prss50 A T 9: 110,863,732 I307F possibly damaging Het
Rgs20 A G 1: 4,912,312 probably null Het
Rnf144b A G 13: 47,239,782 E199G probably damaging Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc22a26 A T 19: 7,790,894 V233E probably damaging Het
Slc27a2 T G 2: 126,553,204 L17R probably benign Het
Slc6a17 A G 3: 107,491,478 V269A probably benign Het
Srp54c T C 12: 55,257,452 V395A probably benign Het
Sspo A T 6: 48,461,647 S1550C possibly damaging Het
Tet1 A G 10: 62,880,039 probably benign Het
Themis A T 10: 28,733,501 H88L probably benign Het
Tmem63b G A 17: 45,660,847 T814M possibly damaging Het
Tnc G A 4: 63,971,232 T1679I probably damaging Het
Tnfrsf11a A G 1: 105,844,730 D581G probably damaging Het
Trim30d A C 7: 104,483,348 V244G probably benign Het
Trpv1 T C 11: 73,260,337 S784P possibly damaging Het
Tulp1 G A 17: 28,356,424 T103M probably damaging Het
Ubap2l A C 3: 90,015,406 V775G unknown Het
Vmn2r69 A C 7: 85,411,764 I204R possibly damaging Het
Vmn2r72 T A 7: 85,750,563 D426V probably benign Het
Vmn2r93 G A 17: 18,313,235 W467* probably null Het
Wbp2nl T C 15: 82,314,341 *360Q probably null Het
Xylt1 G A 7: 117,592,047 probably null Het
Zc3h6 T G 2: 128,993,411 N123K unknown Het
Zfp853 T C 5: 143,289,355 Q185R unknown Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 intron probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6338:Gm11639 UTSW 11 104843208 nonsense probably null
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 intron probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7262:Gm11639 UTSW 11 104854606 critical splice donor site probably null
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
R7411:Gm11639 UTSW 11 104999723 missense probably benign 0.10
R7468:Gm11639 UTSW 11 104749700 missense probably benign 0.17
R7497:Gm11639 UTSW 11 104762690 critical splice donor site probably null
R7620:Gm11639 UTSW 11 104832143 missense possibly damaging 0.95
R7638:Gm11639 UTSW 11 105036799 missense probably benign 0.03
R7661:Gm11639 UTSW 11 104726677 missense probably benign 0.03
R7667:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R7708:Gm11639 UTSW 11 104964571 missense unknown
R7721:Gm11639 UTSW 11 104724540 nonsense probably null
R7747:Gm11639 UTSW 11 104842603 missense probably damaging 0.96
R7840:Gm11639 UTSW 11 104733713 missense probably benign 0.07
R7846:Gm11639 UTSW 11 104714745 critical splice donor site probably null
R7893:Gm11639 UTSW 11 104979360 missense unknown
R7897:Gm11639 UTSW 11 104998235 missense probably benign 0.24
R7923:Gm11639 UTSW 11 104733713 missense probably benign 0.07
R7929:Gm11639 UTSW 11 104714745 critical splice donor site probably null
R7962:Gm11639 UTSW 11 104720636 small deletion probably benign
R7976:Gm11639 UTSW 11 104979360 missense unknown
R7980:Gm11639 UTSW 11 104998235 missense probably benign 0.24
R8031:Gm11639 UTSW 11 104881469 missense not run
R8041:Gm11639 UTSW 11 104919479 missense not run
R8054:Gm11639 UTSW 11 104730400 missense not run
R8056:Gm11639 UTSW 11 104909070 missense not run
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Z1176:Gm11639 UTSW 11 105001967 missense not run
Z1177:Gm11639 UTSW 11 104739338 nonsense probably null
Z1177:Gm11639 UTSW 11 104820518 missense not run
Z1177:Gm11639 UTSW 11 104924019 missense not run
Predicted Primers PCR Primer
(F):5'- TGCAGACAGATGAGCCTCTG -3'
(R):5'- GAACTTGAACGCCCTGAAAC -3'

Sequencing Primer
(F):5'- AGACAGATGAGCCTCTGTGTCTTC -3'
(R):5'- CCCAAAGTATTATCTCCCAATTTAGC -3'
Posted On2019-06-26