Incidental Mutation 'R7323:Olfr1509'
ID568310
Institutional Source Beutler Lab
Gene Symbol Olfr1509
Ensembl Gene ENSMUSG00000035626
Gene Nameolfactory receptor 1509
SynonymsMOR244-3, MOR83, GA_x6K02T2RJGY-534312-533386
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R7323 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52442990-52452574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52451213 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 267 (I267V)
Ref Sequence ENSEMBL: ENSMUSP00000145819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045066] [ENSMUST00000205900] [ENSMUST00000206100] [ENSMUST00000206437] [ENSMUST00000206718] [ENSMUST00000215030]
Predicted Effect probably benign
Transcript: ENSMUST00000045066
AA Change: I267V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046688
Gene: ENSMUSG00000035626
AA Change: I267V

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 301 3.3e-6 PFAM
Pfam:7tm_1 41 287 6.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205900
AA Change: I267V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206100
AA Change: I267V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206437
Predicted Effect probably benign
Transcript: ENSMUST00000206718
Predicted Effect probably benign
Transcript: ENSMUST00000215030
AA Change: I267V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik C A 5: 99,979,086 A9E unknown Het
6030452D12Rik A T 8: 106,500,779 probably null Het
Abcb11 C A 2: 69,287,635 Q466H probably damaging Het
Adam20 A G 8: 40,795,384 D177G probably benign Het
Ampd1 A T 3: 103,085,380 Q150L probably benign Het
Angpt2 A C 8: 18,705,824 M209R probably benign Het
Aoc2 G A 11: 101,328,545 R598Q probably damaging Het
Arap1 A G 7: 101,400,211 D960G probably damaging Het
Bhlhe40 G C 6: 108,665,281 L395F probably benign Het
Cacna1i T C 15: 80,391,653 C1882R possibly damaging Het
Ccr6 A G 17: 8,256,779 N272S possibly damaging Het
Ces1f A T 8: 93,271,844 W175R probably damaging Het
Ces3a A C 8: 105,055,607 H364P possibly damaging Het
Cfap54 T C 10: 92,801,138 M3130V probably benign Het
Clca3b G A 3: 144,825,920 P708S possibly damaging Het
Cps1 A T 1: 67,157,869 T360S probably benign Het
Cramp1l A T 17: 24,982,405 M701K possibly damaging Het
Dnah1 A G 14: 31,298,707 I1235T probably damaging Het
Ergic1 A G 17: 26,641,670 E244G probably damaging Het
Fignl2 C A 15: 101,053,501 R300L unknown Het
Fry T C 5: 150,496,349 M628T Het
Fscn3 A G 6: 28,431,545 T292A possibly damaging Het
Fsip2 A T 2: 82,989,516 I5198L probably benign Het
Gm11639 T C 11: 105,030,011 L4676P probably benign Het
Gm4181 T A 14: 51,632,533 R104W probably damaging Het
Gnl1 G A 17: 35,983,413 R308H probably benign Het
Gtf2h4 G T 17: 35,669,965 L271I probably damaging Het
Helq GTTT GTT 5: 100,783,185 probably null Het
Hhatl A T 9: 121,789,586 W117R probably benign Het
Hlx A G 1: 184,730,796 F220L probably benign Het
Il31ra T C 13: 112,551,963 I27V probably damaging Het
Itga8 T G 2: 12,262,129 D165A probably damaging Het
Krt33a A C 11: 100,011,975 V341G probably benign Het
Lrrc3c A G 11: 98,599,440 M208V possibly damaging Het
Mapk8ip3 A T 17: 24,901,161 S947T probably benign Het
Muc5b A G 7: 141,858,707 I1797V unknown Het
Myh2 A T 11: 67,197,365 T1936S probably benign Het
Nr1h2 T C 7: 44,550,322 Y391C possibly damaging Het
Olfr1168 A G 2: 88,185,608 T244A possibly damaging Het
Olfr1219 A T 2: 89,074,467 I208K probably damaging Het
Olfr355 T A 2: 36,927,974 I47F probably damaging Het
Phf3 A G 1: 30,813,130 M1064T probably benign Het
Pkd1 A G 17: 24,575,051 E1904G probably benign Het
Polrmt A G 10: 79,740,649 V491A probably benign Het
Ppm1j C A 3: 104,784,113 R306S probably damaging Het
Prkd2 T C 7: 16,847,622 F134S probably benign Het
Prpf8 C A 11: 75,491,784 Q439K probably benign Het
Prss50 A T 9: 110,863,732 I307F possibly damaging Het
Rgs20 A G 1: 4,912,312 probably null Het
Rnf144b A G 13: 47,239,782 E199G probably damaging Het
Slc12a4 C T 8: 105,955,715 G121S probably damaging Het
Slc22a26 A T 19: 7,790,894 V233E probably damaging Het
Slc27a2 T G 2: 126,553,204 L17R probably benign Het
Slc6a17 A G 3: 107,491,478 V269A probably benign Het
Srp54c T C 12: 55,257,452 V395A probably benign Het
Sspo A T 6: 48,461,647 S1550C possibly damaging Het
Tet1 A G 10: 62,880,039 probably benign Het
Themis A T 10: 28,733,501 H88L probably benign Het
Tmem63b G A 17: 45,660,847 T814M possibly damaging Het
Tnc G A 4: 63,971,232 T1679I probably damaging Het
Tnfrsf11a A G 1: 105,844,730 D581G probably damaging Het
Trim30d A C 7: 104,483,348 V244G probably benign Het
Trpv1 T C 11: 73,260,337 S784P possibly damaging Het
Tulp1 G A 17: 28,356,424 T103M probably damaging Het
Ubap2l A C 3: 90,015,406 V775G unknown Het
Vmn2r69 A C 7: 85,411,764 I204R possibly damaging Het
Vmn2r72 T A 7: 85,750,563 D426V probably benign Het
Vmn2r93 G A 17: 18,313,235 W467* probably null Het
Wbp2nl T C 15: 82,314,341 *360Q probably null Het
Xylt1 G A 7: 117,592,047 probably null Het
Zc3h6 T G 2: 128,993,411 N123K unknown Het
Zfp853 T C 5: 143,289,355 Q185R unknown Het
Other mutations in Olfr1509
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Olfr1509 APN 14 52451027 missense probably benign 0.00
IGL01694:Olfr1509 APN 14 52450584 missense probably benign
IGL02656:Olfr1509 APN 14 52450709 missense possibly damaging 0.60
R0244:Olfr1509 UTSW 14 52450512 missense probably benign 0.00
R1249:Olfr1509 UTSW 14 52450522 missense probably benign
R1601:Olfr1509 UTSW 14 52450442 missense probably benign 0.00
R1717:Olfr1509 UTSW 14 52450839 missense probably benign 0.00
R1953:Olfr1509 UTSW 14 52450887 missense probably benign 0.00
R4689:Olfr1509 UTSW 14 52451214 missense probably benign
R4943:Olfr1509 UTSW 14 52450594 nonsense probably null
R6223:Olfr1509 UTSW 14 52450679 missense probably benign 0.00
R6516:Olfr1509 UTSW 14 52451129 missense probably damaging 1.00
R7507:Olfr1509 UTSW 14 52450473 missense probably benign 0.00
R7674:Olfr1509 UTSW 14 52450442 missense probably benign 0.00
Z1088:Olfr1509 UTSW 14 52451209 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAATAGTGGAACCATCTCCCTCG -3'
(R):5'- CCAGTGTGAAAGGATCAACCATG -3'

Sequencing Primer
(F):5'- GTATGTTTTCTAGCCTTGGTCAC -3'
(R):5'- CTCAGCGTTTAAGAGCACTTG -3'
Posted On2019-06-26