Incidental Mutation 'R6972:Lmcd1'
ID568326
Institutional Source Beutler Lab
Gene Symbol Lmcd1
Ensembl Gene ENSMUSG00000057604
Gene NameLIM and cysteine-rich domains 1
Synonymsdyxin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6972 (G1)
Quality Score78.0075
Status Validated
Chromosome6
Chromosomal Location112273758-112330425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 112310698 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 115 (T115I)
Ref Sequence ENSEMBL: ENSMUSP00000032376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032376]
Predicted Effect probably damaging
Transcript: ENSMUST00000032376
AA Change: T115I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032376
Gene: ENSMUSG00000057604
AA Change: T115I

DomainStartEndE-ValueType
Pfam:PET 107 201 4.9e-39 PFAM
LIM 242 299 7.29e-8 SMART
LIM 307 359 1.97e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.0%
  • 20x: 95.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LIM-domain family of zinc finger proteins. The encoded protein contains an N-terminal cysteine-rich domain and two C-terminal LIM domains. The presence of LIM domains suggests involvement in protein-protein interactions. The protein may act as a co-regulator of transcription along with other transcription factors. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,109 Y218N probably damaging Het
Abhd2 A G 7: 79,354,027 S285G probably benign Het
Afg1l T C 10: 42,478,374 T10A probably benign Het
Akap9 A G 5: 4,046,699 N2525D possibly damaging Het
B3gnt7 G A 1: 86,305,387 M1I probably null Het
Bdp1 T C 13: 100,037,761 E2089G probably null Het
Calcrl T G 2: 84,368,578 I156L probably benign Het
Cd69 T C 6: 129,269,580 S122G probably benign Het
Chek2 T C 5: 110,855,839 probably null Het
Ckap5 T A 2: 91,606,313 I1586K probably damaging Het
Cyp4f14 C T 17: 32,905,509 A523T probably benign Het
Dcaf1 T A 9: 106,846,772 C466* probably null Het
Dcdc2a A T 13: 25,120,389 probably benign Het
Eml5 T C 12: 98,876,180 I220V probably benign Het
Etv2 T C 7: 30,634,742 N189D probably benign Het
Fam19a2 A G 10: 123,704,373 T45A probably benign Het
Fuz T C 7: 44,897,331 probably benign Het
Git1 T G 11: 77,499,521 V64G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gpr162 C T 6: 124,861,309 R126H probably damaging Het
Grm5 T C 7: 87,602,923 V127A probably benign Het
Iqsec1 T C 6: 90,676,768 D665G probably damaging Het
Kcnh1 A G 1: 192,276,836 I233V probably damaging Het
Mybpc1 T C 10: 88,560,361 E208G possibly damaging Het
Nfic C A 10: 81,420,357 A158S probably benign Het
Nos3 A T 5: 24,380,243 I798L probably benign Het
Ntrk1 A T 3: 87,783,981 L292Q probably damaging Het
Olfr698 A G 7: 106,752,699 S230P possibly damaging Het
Orc4 T C 2: 48,927,184 Q164R probably benign Het
Pcdhb14 T A 18: 37,449,692 V617E probably damaging Het
Plscr3 G A 11: 69,847,958 E149K probably damaging Het
Pltp A G 2: 164,846,592 probably null Het
Pramef6 A G 4: 143,896,902 L234P probably damaging Het
Prg2 G A 2: 84,982,273 R109H probably benign Het
Ptprj G A 2: 90,580,403 S62F possibly damaging Het
Skint3 T A 4: 112,258,892 S240T probably damaging Het
Smarca5 A G 8: 80,704,751 Y946H probably damaging Het
Taf4b T C 18: 14,813,347 V409A possibly damaging Het
Trim29 T A 9: 43,327,112 N504K probably benign Het
Vmn2r77 T C 7: 86,802,994 Y461H probably damaging Het
Zeb2 T C 2: 44,997,318 K531E probably damaging Het
Zfp687 A G 3: 95,009,377 S813P possibly damaging Het
Other mutations in Lmcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Lmcd1 APN 6 112329808 missense probably benign 0.29
IGL00963:Lmcd1 APN 6 112329934 missense probably damaging 1.00
IGL01339:Lmcd1 APN 6 112310625 missense probably benign
IGL01373:Lmcd1 APN 6 112310625 missense probably benign
IGL03088:Lmcd1 APN 6 112310688 missense probably damaging 1.00
IGL03090:Lmcd1 APN 6 112310499 missense probably benign 0.32
R0940:Lmcd1 UTSW 6 112328697 missense probably benign 0.01
R1144:Lmcd1 UTSW 6 112310751 splice site probably benign
R1245:Lmcd1 UTSW 6 112315712 missense probably benign 0.01
R1338:Lmcd1 UTSW 6 112305128 missense probably damaging 1.00
R1567:Lmcd1 UTSW 6 112310565 missense probably damaging 1.00
R1615:Lmcd1 UTSW 6 112273950 missense probably benign 0.40
R1748:Lmcd1 UTSW 6 112329914 missense probably benign 0.01
R1793:Lmcd1 UTSW 6 112328751 missense probably benign 0.00
R2014:Lmcd1 UTSW 6 112328741 missense probably damaging 1.00
R2042:Lmcd1 UTSW 6 112315890 missense probably benign 0.00
R4322:Lmcd1 UTSW 6 112315763 missense possibly damaging 0.54
R4344:Lmcd1 UTSW 6 112288007 intron probably benign
R4771:Lmcd1 UTSW 6 112315873 missense probably damaging 1.00
R4863:Lmcd1 UTSW 6 112287871 intron probably benign
R5256:Lmcd1 UTSW 6 112288126 intron probably benign
R5296:Lmcd1 UTSW 6 112315588 missense probably damaging 1.00
R6453:Lmcd1 UTSW 6 112315828 missense probably benign
R7239:Lmcd1 UTSW 6 112315784 missense possibly damaging 0.94
R7278:Lmcd1 UTSW 6 112310539 missense possibly damaging 0.73
Z1177:Lmcd1 UTSW 6 112310674 missense possibly damaging 0.68
Z1177:Lmcd1 UTSW 6 112310676 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGGATGGTCTCACTTGCTTCC -3'
(R):5'- TGCTTCATCATTACCTGAGCCAG -3'

Sequencing Primer
(F):5'- GCAAGTCTTGTAAATGCAGCC -3'
(R):5'- CTGAGCCAGGAGTAGAGCTG -3'
Posted On2019-07-01