Incidental Mutation 'R6954:Igfbpl1'
ID 568328
Institutional Source Beutler Lab
Gene Symbol Igfbpl1
Ensembl Gene ENSMUSG00000035551
Gene Name insulin-like growth factor binding protein-like 1
Synonyms 2810011G06Rik, 2810453O06Rik, IGFBP-like protein
MMRRC Submission 045066-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R6954 (G1)
Quality Score 49.0072
Status Validated
Chromosome 4
Chromosomal Location 45809507-45826827 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 45826663 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 44 (C44Y)
Ref Sequence ENSEMBL: ENSMUSP00000036974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044297]
AlphaFold Q80W15
Predicted Effect probably damaging
Transcript: ENSMUST00000044297
AA Change: C44Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036974
Gene: ENSMUSG00000035551
AA Change: C44Y

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IB 28 100 1.31e-3 SMART
KAZAL 82 143 6.59e-14 SMART
IGc2 159 242 5.04e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik A T 7: 126,429,809 (GRCm39) probably null Het
Alox5 A C 6: 116,397,241 (GRCm39) Y314* probably null Het
Ap4e1 T C 2: 126,906,871 (GRCm39) S1044P probably benign Het
Ash2l A G 8: 26,312,796 (GRCm39) V391A possibly damaging Het
B4galnt4 A G 7: 140,647,145 (GRCm39) T326A probably benign Het
Ccm2 T A 11: 6,544,239 (GRCm39) I345N probably damaging Het
Cntnap3 G A 13: 64,896,373 (GRCm39) H1034Y probably benign Het
Cpsf1 A G 15: 76,483,696 (GRCm39) L849S probably damaging Het
Ctrb1 A G 8: 112,413,296 (GRCm39) S239P probably damaging Het
Dennd1b T A 1: 139,096,683 (GRCm39) probably benign Het
Dnah17 A G 11: 117,957,258 (GRCm39) I2773T probably damaging Het
Eif2b2 T A 12: 85,272,817 (GRCm39) F267L probably damaging Het
Fcrl2 A G 3: 87,170,983 (GRCm39) probably benign Het
Furin G T 7: 80,046,712 (GRCm39) D181E possibly damaging Het
Gm29106 T A 1: 118,128,317 (GRCm39) C670S probably damaging Het
Gm6309 A T 5: 146,105,300 (GRCm39) D204E possibly damaging Het
Hsf2 T A 10: 57,380,739 (GRCm39) I191N probably damaging Het
Hspa12a T C 19: 58,788,124 (GRCm39) D566G probably benign Het
Igf1 G C 10: 87,700,722 (GRCm39) V49L probably damaging Het
Letm1 G A 5: 33,939,851 (GRCm39) R16C probably benign Het
Lypd8l T A 11: 58,499,314 (GRCm39) Y168F probably benign Het
Marf1 A G 16: 13,956,384 (GRCm39) V819A probably damaging Het
Mfsd4b4 A T 10: 39,767,948 (GRCm39) S428T probably benign Het
Myo1d T C 11: 80,565,783 (GRCm39) I347M probably benign Het
Myo9b A G 8: 71,743,463 (GRCm39) I175V probably damaging Het
Naip5 A T 13: 100,359,922 (GRCm39) V438E probably damaging Het
Nup205 T A 6: 35,185,044 (GRCm39) V768E possibly damaging Het
Or4k6 A T 14: 50,475,567 (GRCm39) Y258* probably null Het
Or9g4b T A 2: 85,616,726 (GRCm39) Y290* probably null Het
Pcdh15 C T 10: 74,481,821 (GRCm39) H1651Y possibly damaging Het
Pdgfra A T 5: 75,334,055 (GRCm39) Q376L possibly damaging Het
Pign T C 1: 105,481,622 (GRCm39) I791M probably benign Het
Pik3c2b T G 1: 132,994,041 (GRCm39) S2A possibly damaging Het
Pip5k1a A T 3: 94,975,558 (GRCm39) I304K probably damaging Het
Pkdrej A T 15: 85,702,054 (GRCm39) L1294* probably null Het
Pprc1 T C 19: 46,052,872 (GRCm39) S797P probably damaging Het
Prob1 A G 18: 35,787,321 (GRCm39) V311A probably benign Het
Prune2 C A 19: 16,977,385 (GRCm39) T40K probably damaging Het
Rif1 T G 2: 52,002,703 (GRCm39) D2052E probably benign Het
Sall1 A G 8: 89,759,519 (GRCm39) V195A probably damaging Het
Scfd1 T C 12: 51,474,729 (GRCm39) probably null Het
Sidt2 A T 9: 45,864,148 (GRCm39) N123K probably benign Het
Slc22a6 G A 19: 8,599,460 (GRCm39) A320T probably benign Het
Slc25a10 A G 11: 120,388,973 (GRCm39) H279R probably benign Het
Slc35b4 A G 6: 34,135,556 (GRCm39) V252A probably benign Het
Slc46a3 T C 5: 147,823,150 (GRCm39) T231A probably benign Het
Stxbp1 T A 2: 32,691,905 (GRCm39) H429L probably damaging Het
Tas2r134 C T 2: 51,517,782 (GRCm39) T87I probably benign Het
Tcstv6 A G 13: 120,307,666 (GRCm39) D20G possibly damaging Het
Tdpoz2 A T 3: 93,559,582 (GRCm39) L130H probably damaging Het
Tmem69 T C 4: 116,411,921 (GRCm39) probably null Het
Tmppe G A 9: 114,234,591 (GRCm39) V297I probably benign Het
Ung G T 5: 114,269,398 (GRCm39) A37S probably benign Het
Vdac1 T C 11: 52,277,200 (GRCm39) Y237H probably damaging Het
Vgll4 T C 6: 114,898,328 (GRCm39) Y11C probably damaging Het
Vmn1r24 A G 6: 57,933,437 (GRCm39) I27T probably benign Het
Zfp280b T A 10: 75,875,522 (GRCm39) M467K probably benign Het
Zkscan4 A G 13: 21,668,535 (GRCm39) I329V probably damaging Het
Other mutations in Igfbpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Igfbpl1 APN 4 45,826,478 (GRCm39) missense probably damaging 0.99
IGL03339:Igfbpl1 APN 4 45,813,555 (GRCm39) splice site probably benign
PIT1430001:Igfbpl1 UTSW 4 45,826,756 (GRCm39) missense unknown
PIT4504001:Igfbpl1 UTSW 4 45,813,469 (GRCm39) missense possibly damaging 0.86
R1824:Igfbpl1 UTSW 4 45,826,406 (GRCm39) missense probably benign 0.19
R2655:Igfbpl1 UTSW 4 45,816,289 (GRCm39) missense probably damaging 0.96
R3850:Igfbpl1 UTSW 4 45,826,426 (GRCm39) missense probably benign 0.02
R5431:Igfbpl1 UTSW 4 45,815,588 (GRCm39) missense probably benign 0.21
R5695:Igfbpl1 UTSW 4 45,826,374 (GRCm39) missense probably damaging 1.00
R6229:Igfbpl1 UTSW 4 45,813,517 (GRCm39) missense probably damaging 1.00
R6613:Igfbpl1 UTSW 4 45,813,447 (GRCm39) missense probably benign 0.00
R6950:Igfbpl1 UTSW 4 45,815,494 (GRCm39) missense probably damaging 1.00
R6971:Igfbpl1 UTSW 4 45,816,333 (GRCm39) missense possibly damaging 0.72
R7558:Igfbpl1 UTSW 4 45,813,497 (GRCm39) missense probably damaging 1.00
R7976:Igfbpl1 UTSW 4 45,826,786 (GRCm39) missense unknown
R8675:Igfbpl1 UTSW 4 45,813,469 (GRCm39) missense possibly damaging 0.86
R9354:Igfbpl1 UTSW 4 45,816,348 (GRCm39) missense probably damaging 1.00
R9394:Igfbpl1 UTSW 4 45,826,792 (GRCm39) start codon destroyed probably null
R9598:Igfbpl1 UTSW 4 45,815,472 (GRCm39) missense probably null 0.98
Predicted Primers PCR Primer
(F):5'- GTCTTTCTAGGTCAAACCCCAC -3'
(R):5'- GCAGTTCAGTGAGCCAGTAG -3'

Sequencing Primer
(F):5'- ATCGCGAGCCTTGTGCAG -3'
(R):5'- CTTTGCACGCACCGAGC -3'
Posted On 2019-07-01