Incidental Mutation 'R6954:Vdac1'
ID568332
Institutional Source Beutler Lab
Gene Symbol Vdac1
Ensembl Gene ENSMUSG00000020402
Gene Namevoltage-dependent anion channel 1
SynonymsVdac5
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.664) question?
Stock #R6954 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location52360860-52389397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52386373 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 237 (Y237H)
Ref Sequence ENSEMBL: ENSMUSP00000116919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020673] [ENSMUST00000102758] [ENSMUST00000125694]
Predicted Effect probably benign
Transcript: ENSMUST00000020673
SMART Domains Protein: ENSMUSP00000020673
Gene: ENSMUSG00000020402

DomainStartEndE-ValueType
Pfam:Porin_3 16 289 1.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102758
SMART Domains Protein: ENSMUSP00000099819
Gene: ENSMUSG00000020402

DomainStartEndE-ValueType
Pfam:Porin_3 3 276 7.6e-80 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125694
AA Change: Y237H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116919
Gene: ENSMUSG00000020402
AA Change: Y237H

DomainStartEndE-ValueType
Pfam:Porin_3 3 235 1.7e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a voltage-dependent anion channel protein that is a major component of the outer mitochondrial membrane. The encoded protein facilitates the exchange of metabolites and ions across the outer mitochondrial membrane and may regulate mitochondrial functions. This protein also forms channels in the plasma membrane and may be involved in transmembrane electron transport. Multiple pseudogenes of this gene are found on chromosomes 1, 2, 3, 6, 8, 9, and X. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants exhibit approximately 60% embryonic mortality, with loss occurring at embryonic day 10.5-11.5. Survivors exhibit defective cued fear conditioning and spatial learning. Heterozygotes also exhibit about 12% prenatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Vdac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Vdac1 APN 11 52385662 missense probably benign 0.02
IGL02057:Vdac1 APN 11 52376544 critical splice donor site probably null
IGL03223:Vdac1 APN 11 52376655 missense probably benign
IGL03225:Vdac1 APN 11 52376655 missense probably benign
R0362:Vdac1 UTSW 11 52374973 splice site probably benign
R1612:Vdac1 UTSW 11 52384070 missense probably benign 0.03
R1694:Vdac1 UTSW 11 52374363 missense probably damaging 0.96
R2512:Vdac1 UTSW 11 52384077 missense probably damaging 1.00
R3717:Vdac1 UTSW 11 52376646 critical splice acceptor site probably null
R4592:Vdac1 UTSW 11 52374972 splice site probably null
R5027:Vdac1 UTSW 11 52388478 missense possibly damaging 0.75
R5209:Vdac1 UTSW 11 52376452 missense probably damaging 0.99
R5256:Vdac1 UTSW 11 52384078 critical splice donor site probably null
R5413:Vdac1 UTSW 11 52374967 missense probably null 0.17
R5762:Vdac1 UTSW 11 52387453 missense possibly damaging 0.77
R6276:Vdac1 UTSW 11 52376482 missense possibly damaging 0.84
R7023:Vdac1 UTSW 11 52374366 missense probably damaging 0.99
R7261:Vdac1 UTSW 11 52374934 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCACAGGGCAAAGACAAGTC -3'
(R):5'- CCTGACCATTGATGTCTTAATGTGG -3'

Sequencing Primer
(F):5'- TGTGCGCCACGATATTGAC -3'
(R):5'- GATGTCTTAATGTGGATGTAGAGAC -3'
Posted On2019-07-01