Incidental Mutation 'R6954:Vdac1'
ID 568332
Institutional Source Beutler Lab
Gene Symbol Vdac1
Ensembl Gene ENSMUSG00000020402
Gene Name voltage-dependent anion channel 1
Synonyms Vdac5
MMRRC Submission 045066-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.844) question?
Stock # R6954 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 52251905-52280224 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52277200 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 237 (Y237H)
Ref Sequence ENSEMBL: ENSMUSP00000116919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020673] [ENSMUST00000102758] [ENSMUST00000125694]
AlphaFold Q60932
Predicted Effect probably benign
Transcript: ENSMUST00000020673
SMART Domains Protein: ENSMUSP00000020673
Gene: ENSMUSG00000020402

DomainStartEndE-ValueType
Pfam:Porin_3 16 289 1.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102758
SMART Domains Protein: ENSMUSP00000099819
Gene: ENSMUSG00000020402

DomainStartEndE-ValueType
Pfam:Porin_3 3 276 7.6e-80 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125694
AA Change: Y237H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116919
Gene: ENSMUSG00000020402
AA Change: Y237H

DomainStartEndE-ValueType
Pfam:Porin_3 3 235 1.7e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a voltage-dependent anion channel protein that is a major component of the outer mitochondrial membrane. The encoded protein facilitates the exchange of metabolites and ions across the outer mitochondrial membrane and may regulate mitochondrial functions. This protein also forms channels in the plasma membrane and may be involved in transmembrane electron transport. Multiple pseudogenes of this gene are found on chromosomes 1, 2, 3, 6, 8, 9, and X. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants exhibit approximately 60% embryonic mortality, with loss occurring at embryonic day 10.5-11.5. Survivors exhibit defective cued fear conditioning and spatial learning. Heterozygotes also exhibit about 12% prenatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik A T 7: 126,429,809 (GRCm39) probably null Het
Alox5 A C 6: 116,397,241 (GRCm39) Y314* probably null Het
Ap4e1 T C 2: 126,906,871 (GRCm39) S1044P probably benign Het
Ash2l A G 8: 26,312,796 (GRCm39) V391A possibly damaging Het
B4galnt4 A G 7: 140,647,145 (GRCm39) T326A probably benign Het
Ccm2 T A 11: 6,544,239 (GRCm39) I345N probably damaging Het
Cntnap3 G A 13: 64,896,373 (GRCm39) H1034Y probably benign Het
Cpsf1 A G 15: 76,483,696 (GRCm39) L849S probably damaging Het
Ctrb1 A G 8: 112,413,296 (GRCm39) S239P probably damaging Het
Dennd1b T A 1: 139,096,683 (GRCm39) probably benign Het
Dnah17 A G 11: 117,957,258 (GRCm39) I2773T probably damaging Het
Eif2b2 T A 12: 85,272,817 (GRCm39) F267L probably damaging Het
Fcrl2 A G 3: 87,170,983 (GRCm39) probably benign Het
Furin G T 7: 80,046,712 (GRCm39) D181E possibly damaging Het
Gm29106 T A 1: 118,128,317 (GRCm39) C670S probably damaging Het
Gm6309 A T 5: 146,105,300 (GRCm39) D204E possibly damaging Het
Hsf2 T A 10: 57,380,739 (GRCm39) I191N probably damaging Het
Hspa12a T C 19: 58,788,124 (GRCm39) D566G probably benign Het
Igf1 G C 10: 87,700,722 (GRCm39) V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 (GRCm39) C44Y probably damaging Het
Letm1 G A 5: 33,939,851 (GRCm39) R16C probably benign Het
Lypd8l T A 11: 58,499,314 (GRCm39) Y168F probably benign Het
Marf1 A G 16: 13,956,384 (GRCm39) V819A probably damaging Het
Mfsd4b4 A T 10: 39,767,948 (GRCm39) S428T probably benign Het
Myo1d T C 11: 80,565,783 (GRCm39) I347M probably benign Het
Myo9b A G 8: 71,743,463 (GRCm39) I175V probably damaging Het
Naip5 A T 13: 100,359,922 (GRCm39) V438E probably damaging Het
Nup205 T A 6: 35,185,044 (GRCm39) V768E possibly damaging Het
Or4k6 A T 14: 50,475,567 (GRCm39) Y258* probably null Het
Or9g4b T A 2: 85,616,726 (GRCm39) Y290* probably null Het
Pcdh15 C T 10: 74,481,821 (GRCm39) H1651Y possibly damaging Het
Pdgfra A T 5: 75,334,055 (GRCm39) Q376L possibly damaging Het
Pign T C 1: 105,481,622 (GRCm39) I791M probably benign Het
Pik3c2b T G 1: 132,994,041 (GRCm39) S2A possibly damaging Het
Pip5k1a A T 3: 94,975,558 (GRCm39) I304K probably damaging Het
Pkdrej A T 15: 85,702,054 (GRCm39) L1294* probably null Het
Pprc1 T C 19: 46,052,872 (GRCm39) S797P probably damaging Het
Prob1 A G 18: 35,787,321 (GRCm39) V311A probably benign Het
Prune2 C A 19: 16,977,385 (GRCm39) T40K probably damaging Het
Rif1 T G 2: 52,002,703 (GRCm39) D2052E probably benign Het
Sall1 A G 8: 89,759,519 (GRCm39) V195A probably damaging Het
Scfd1 T C 12: 51,474,729 (GRCm39) probably null Het
Sidt2 A T 9: 45,864,148 (GRCm39) N123K probably benign Het
Slc22a6 G A 19: 8,599,460 (GRCm39) A320T probably benign Het
Slc25a10 A G 11: 120,388,973 (GRCm39) H279R probably benign Het
Slc35b4 A G 6: 34,135,556 (GRCm39) V252A probably benign Het
Slc46a3 T C 5: 147,823,150 (GRCm39) T231A probably benign Het
Stxbp1 T A 2: 32,691,905 (GRCm39) H429L probably damaging Het
Tas2r134 C T 2: 51,517,782 (GRCm39) T87I probably benign Het
Tcstv6 A G 13: 120,307,666 (GRCm39) D20G possibly damaging Het
Tdpoz2 A T 3: 93,559,582 (GRCm39) L130H probably damaging Het
Tmem69 T C 4: 116,411,921 (GRCm39) probably null Het
Tmppe G A 9: 114,234,591 (GRCm39) V297I probably benign Het
Ung G T 5: 114,269,398 (GRCm39) A37S probably benign Het
Vgll4 T C 6: 114,898,328 (GRCm39) Y11C probably damaging Het
Vmn1r24 A G 6: 57,933,437 (GRCm39) I27T probably benign Het
Zfp280b T A 10: 75,875,522 (GRCm39) M467K probably benign Het
Zkscan4 A G 13: 21,668,535 (GRCm39) I329V probably damaging Het
Other mutations in Vdac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Vdac1 APN 11 52,276,489 (GRCm39) missense probably benign 0.02
IGL02057:Vdac1 APN 11 52,267,371 (GRCm39) critical splice donor site probably null
IGL03223:Vdac1 APN 11 52,267,482 (GRCm39) missense probably benign
IGL03225:Vdac1 APN 11 52,267,482 (GRCm39) missense probably benign
R0362:Vdac1 UTSW 11 52,265,800 (GRCm39) splice site probably benign
R1612:Vdac1 UTSW 11 52,274,897 (GRCm39) missense probably benign 0.03
R1694:Vdac1 UTSW 11 52,265,190 (GRCm39) missense probably damaging 0.96
R2512:Vdac1 UTSW 11 52,274,904 (GRCm39) missense probably damaging 1.00
R3717:Vdac1 UTSW 11 52,267,473 (GRCm39) critical splice acceptor site probably null
R4592:Vdac1 UTSW 11 52,265,799 (GRCm39) splice site probably null
R5027:Vdac1 UTSW 11 52,279,305 (GRCm39) missense possibly damaging 0.75
R5209:Vdac1 UTSW 11 52,267,279 (GRCm39) missense probably damaging 0.99
R5256:Vdac1 UTSW 11 52,274,905 (GRCm39) critical splice donor site probably null
R5413:Vdac1 UTSW 11 52,265,794 (GRCm39) missense probably null 0.17
R5762:Vdac1 UTSW 11 52,278,280 (GRCm39) missense possibly damaging 0.77
R6276:Vdac1 UTSW 11 52,267,309 (GRCm39) missense possibly damaging 0.84
R7023:Vdac1 UTSW 11 52,265,193 (GRCm39) missense probably damaging 0.99
R7261:Vdac1 UTSW 11 52,265,761 (GRCm39) missense probably damaging 0.98
R8414:Vdac1 UTSW 11 52,267,330 (GRCm39) missense possibly damaging 0.69
R8847:Vdac1 UTSW 11 52,267,230 (GRCm39) missense
R9276:Vdac1 UTSW 11 52,274,789 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACAGGGCAAAGACAAGTC -3'
(R):5'- CCTGACCATTGATGTCTTAATGTGG -3'

Sequencing Primer
(F):5'- TGTGCGCCACGATATTGAC -3'
(R):5'- GATGTCTTAATGTGGATGTAGAGAC -3'
Posted On 2019-07-01