Mutagenetix > Incidental Mutation

Incidental Mutation 'R7076:Dip2b'

568335

Institutional Source

Beutler Lab

Gene Symbol

Dip2b

Ensembl Gene

ENSMUSG00000023026

Gene Name

disco interacting protein 2 homolog B

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.709) question?

Stock #

R7076 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100038664-100219473 bp(+) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

A to G at 100157972 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000097777 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]

AlphaFold

Q3UH60

Predicted Effect

probably null
Transcript: ENSMUST00000023768

SMART Domains

Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	109	584	9.5e-26	PFAM
Pfam:AMP-binding	760	1235	1.2e-52	PFAM
low complexity region	1299	1311	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000100203

SMART Domains

Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026

Domain	Start	End	E-Value	Type
DMAP_binding	12	130	1e-42	SMART
low complexity region	152	168	N/A	INTRINSIC
low complexity region	181	192	N/A	INTRINSIC
Pfam:AMP-binding	341	817	2e-26	PFAM
Pfam:AMP-binding	993	1468	1.8e-64	PFAM
low complexity region	1532	1544	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam29	A	G	8: 55,871,659	C587R	probably damaging	Het
Adgrg7	T	C	16: 56,742,406	T523A	probably damaging	Het
Arrdc3	A	T	13: 80,890,696	K259M	probably damaging	Het
Becn1	A	T	11: 101,295,324	N151K	probably benign	Het
Cars2	C	T	8: 11,529,649	E270K	probably damaging	Het
Ccp110	C	A	7: 118,732,405	P943Q	probably damaging	Het
Ccser2	A	G	14: 36,939,829	I466T	probably benign	Het
Cd164	A	G	10: 41,523,197	E94G	probably benign	Het
Cdon	C	T	9: 35,504,150	T1228I	probably benign	Het
Cubn	C	A	2: 13,306,280	V3145L	probably benign	Het
Cubn	T	A	2: 13,306,281	K3144N	probably benign	Het
Dchs1	A	G	7: 105,761,871	V1649A	probably benign	Het
Dgka	A	T	10: 128,733,583	D153E	probably damaging	Het
Dnajc21	T	C	15: 10,449,631	T435A	probably benign	Het
F830016B08Rik	A	T	18: 60,300,471	I209F	probably damaging	Het
Ghdc	C	A	11: 100,769,714	S111I	possibly damaging	Het
Gm19965	T	C	1: 116,821,275	C229R		Het
Gpm6a	C	T	8: 55,037,451	T54I	probably damaging	Het
Gpr171	G	T	3: 59,098,156	A66E	probably damaging	Het
Grm7	A	G	6: 111,358,152	D508G	probably benign	Het
Has1	G	A	17: 17,843,806	R524C	probably damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ighv3-8	A	T	12: 114,322,782	L7Q	probably damaging	Het
Ints10	A	T	8: 68,796,751	R78*	probably null	Het
Itpr1	A	G	6: 108,388,296	I903V	probably benign	Het
Lrp1	A	G	10: 127,550,183		probably null	Het
Mki67	A	G	7: 135,705,629	V132A	probably damaging	Het
Myh4	A	G	11: 67,253,173	E1123G	possibly damaging	Het
Neurog3	A	G	10: 62,133,580	T40A	probably benign	Het
Nipsnap3b	T	A	4: 53,021,095		probably null	Het
Nr4a3	G	A	4: 48,055,957	V328I	probably damaging	Het
Olfr1489	G	T	19: 13,633,880	M256I	possibly damaging	Het
Olfr313	G	A	11: 58,817,164	R52Q	probably benign	Het
Olfr487	A	T	7: 108,211,998	V177D	probably damaging	Het
Olfr654	A	T	7: 104,588,223	S140C	probably damaging	Het
Olfr716	T	C	7: 107,148,029	F238L	probably damaging	Het
Olfr743	T	A	14: 50,533,821	Y136*	probably null	Het
Osbpl5	A	G	7: 143,709,840	L102P	probably benign	Het
Ppl	C	T	16: 5,100,119	R503Q	probably damaging	Het
Ppp2r2d	T	C	7: 138,876,597	M321T	possibly damaging	Het
Prex1	T	C	2: 166,633,382	Y197C	probably damaging	Het
Prss32	A	G	17: 23,853,921	D42G	possibly damaging	Het
Ralgapa1	T	C	12: 55,721,576	E1210G	possibly damaging	Het
Sdr16c5	A	G	4: 4,006,591	C234R	probably damaging	Het
Slc23a4	A	G	6: 34,956,884	S95P	probably damaging	Het
Srp14	T	C	2: 118,479,390	T29A	probably damaging	Het
Tet2	T	A	3: 133,467,023	H1826L	possibly damaging	Het
Tfr2	A	T	5: 137,583,574	Y641F	probably damaging	Het
Tmco5b	A	G	2: 113,287,421	N27D	probably damaging	Het
Tvp23a	T	C	16: 10,428,735	D62G	probably benign	Het
Usp12	A	G	5: 146,737,752	F347S	possibly damaging	Het
Zfp407	A	T	18: 84,558,476	L1504Q	probably damaging	Het
Zfp524	A	G	7: 5,017,896	D141G	possibly damaging	Het
Zfp68	A	G	5: 138,606,939	I374T	possibly damaging	Het
Zfp758	C	T	17: 22,375,156	H208Y	probably benign	Het
Zfp804b	T	C	5: 6,769,751	H1104R	probably benign	Het
Znrf2	T	A	6: 54,842,695	*75K	probably null	Het
Zzef1	T	C	11: 72,899,559	V2113A	probably benign	Het

Other mutations in Dip2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Dip2b	APN	15	100174501	missense	probably damaging	1.00
IGL01716:Dip2b	APN	15	100209636	missense	probably benign	0.00
IGL01893:Dip2b	APN	15	100171220	splice site	probably benign
IGL01915:Dip2b	APN	15	100178511	missense	probably damaging	1.00
IGL02125:Dip2b	APN	15	100186250	missense	possibly damaging	0.60
IGL02200:Dip2b	APN	15	100151202	missense	possibly damaging	0.93
IGL02506:Dip2b	APN	15	100157281	missense	probably damaging	1.00
IGL02571:Dip2b	APN	15	100157885	missense	possibly damaging	0.93
IGL02706:Dip2b	APN	15	100215311	missense	probably damaging	0.98
IGL02983:Dip2b	APN	15	100132022	missense	possibly damaging	0.81
IGL03120:Dip2b	APN	15	100203127	splice site	probably benign
IGL03181:Dip2b	APN	15	100215207	missense	probably damaging	0.98
IGL03229:Dip2b	APN	15	100207838	splice site	probably benign
IGL03399:Dip2b	APN	15	100175327	missense	possibly damaging	0.63
PIT4131001:Dip2b	UTSW	15	100202352	missense	probably damaging	1.00
R0009:Dip2b	UTSW	15	100169312	missense	probably damaging	1.00
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0092:Dip2b	UTSW	15	100202265	missense	probably damaging	1.00
R0201:Dip2b	UTSW	15	100186147	missense	probably damaging	0.98
R0359:Dip2b	UTSW	15	100211993	missense	probably damaging	0.98
R0390:Dip2b	UTSW	15	100193913	missense	probably damaging	0.99
R0564:Dip2b	UTSW	15	100162719	nonsense	probably null
R0730:Dip2b	UTSW	15	100171651	missense	probably damaging	1.00
R1144:Dip2b	UTSW	15	100154250	missense	probably benign	0.11
R1200:Dip2b	UTSW	15	100209745	missense	probably benign	0.00
R1506:Dip2b	UTSW	15	100183113	missense	probably damaging	1.00
R1750:Dip2b	UTSW	15	100178466	missense	probably benign
R1760:Dip2b	UTSW	15	100212029	missense	probably damaging	1.00
R1773:Dip2b	UTSW	15	100193961	missense	probably benign	0.00
R1812:Dip2b	UTSW	15	100198938	splice site	probably null
R2264:Dip2b	UTSW	15	100203216	missense	probably benign	0.05
R3105:Dip2b	UTSW	15	100142137	nonsense	probably null
R4029:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4030:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4296:Dip2b	UTSW	15	100181336	missense	probably benign
R4392:Dip2b	UTSW	15	100162036	missense	probably damaging	1.00
R4480:Dip2b	UTSW	15	100186301	missense	probably damaging	0.99
R4564:Dip2b	UTSW	15	100157258	nonsense	probably null
R4605:Dip2b	UTSW	15	100209636	missense	probably benign	0.00
R4606:Dip2b	UTSW	15	100215329	missense	possibly damaging	0.91
R4634:Dip2b	UTSW	15	100160491	missense	probably damaging	1.00
R4667:Dip2b	UTSW	15	100151360	missense	probably benign	0.01
R4739:Dip2b	UTSW	15	100207777	missense	probably damaging	0.98
R4826:Dip2b	UTSW	15	100169281	missense	probably damaging	0.99
R4870:Dip2b	UTSW	15	100195784	splice site	probably null
R4877:Dip2b	UTSW	15	100160529	missense	possibly damaging	0.49
R4932:Dip2b	UTSW	15	100171722	missense	probably damaging	1.00
R5009:Dip2b	UTSW	15	100195784	splice site	probably null
R5169:Dip2b	UTSW	15	100205113	missense	probably damaging	1.00
R5216:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5218:Dip2b	UTSW	15	100154296	missense	probably benign	0.00
R5274:Dip2b	UTSW	15	100212104	missense	possibly damaging	0.54
R5370:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5420:Dip2b	UTSW	15	100205173	intron	probably benign
R5447:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5670:Dip2b	UTSW	15	100190104	missense	possibly damaging	0.80
R5768:Dip2b	UTSW	15	100157945	missense	probably benign	0.32
R5908:Dip2b	UTSW	15	100151184	missense	possibly damaging	0.93
R5957:Dip2b	UTSW	15	100209694	missense	probably benign	0.03
R5987:Dip2b	UTSW	15	100190079	missense	probably damaging	1.00
R6260:Dip2b	UTSW	15	100162702	missense	probably benign	0.05
R6325:Dip2b	UTSW	15	100154282	missense	probably benign	0.00
R6367:Dip2b	UTSW	15	100115914	missense	possibly damaging	0.50
R6391:Dip2b	UTSW	15	100151276	missense	probably damaging	1.00
R6422:Dip2b	UTSW	15	100199011	missense	probably damaging	0.98
R6818:Dip2b	UTSW	15	100193954	missense	probably benign	0.09
R6922:Dip2b	UTSW	15	100193843	missense	probably benign	0.25
R7002:Dip2b	UTSW	15	100160465	missense	probably benign	0.43
R7176:Dip2b	UTSW	15	100169318	missense	probably damaging	1.00
R7255:Dip2b	UTSW	15	100209627	missense	probably benign	0.00
R7463:Dip2b	UTSW	15	100154157	missense	probably benign
R7513:Dip2b	UTSW	15	100207748	splice site	probably null
R7876:Dip2b	UTSW	15	100191041	missense	probably benign	0.02
R8368:Dip2b	UTSW	15	100154243	missense	probably benign	0.00
R9289:Dip2b	UTSW	15	100173271	missense	probably damaging	0.97
R9405:Dip2b	UTSW	15	100195876	missense	probably benign	0.05
R9477:Dip2b	UTSW	15	100038903	missense	probably damaging	1.00
R9485:Dip2b	UTSW	15	100155043	missense	probably benign	0.05
R9533:Dip2b	UTSW	15	100175297	missense	probably benign	0.06
R9581:Dip2b	UTSW	15	100181374	missense	probably damaging	0.99
R9666:Dip2b	UTSW	15	100209580	missense	probably damaging	1.00
X0064:Dip2b	UTSW	15	100115850	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCAACCTAATGCTCTCTGG -3'
(R):5'- AGACTGCTGTTGGAACTCTGTC -3'

Sequencing Primer
(F):5'- AACCTAATGCTCTCTGGCTGAAG -3'
(R):5'- CGACCATTTGTAACTCAAGGTCAGG -3'

Posted On

2019-07-01