Incidental Mutation 'R6950:Lrrc36'
ID568356
Institutional Source Beutler Lab
Gene Symbol Lrrc36
Ensembl Gene ENSMUSG00000054320
Gene Nameleucine rich repeat containing 36
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6950 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105413571-105464086 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to T at 105425389 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067305] [ENSMUST00000109355] [ENSMUST00000213547] [ENSMUST00000216765]
Predicted Effect probably benign
Transcript: ENSMUST00000067305
SMART Domains Protein: ENSMUSP00000066345
Gene: ENSMUSG00000054320

DomainStartEndE-ValueType
low complexity region 377 389 N/A INTRINSIC
coiled coil region 478 550 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109355
SMART Domains Protein: ENSMUSP00000104979
Gene: ENSMUSG00000054320

DomainStartEndE-ValueType
Pfam:LRR_8 24 84 2.9e-8 PFAM
low complexity region 500 512 N/A INTRINSIC
coiled coil region 601 673 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000213547
Predicted Effect probably null
Transcript: ENSMUST00000216765
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,411,616 V404D probably damaging Het
Adcy2 A G 13: 68,888,065 M159T possibly damaging Het
Agtpbp1 T C 13: 59,450,266 K674R probably benign Het
Atxn7 C A 14: 14,095,511 P403H probably damaging Het
Cav3 C T 6: 112,472,210 T63I probably damaging Het
Ccr6 T C 17: 8,257,066 *368Q probably null Het
Cdh8 A T 8: 99,030,763 N734K probably benign Het
Ces5a G T 8: 93,530,774 N134K probably benign Het
Cisd3 T G 11: 97,686,160 probably null Het
Cyp4f39 T G 17: 32,492,306 C476G probably damaging Het
Dffb A T 4: 153,970,092 M180K probably benign Het
Dock4 A G 12: 40,733,314 E749G possibly damaging Het
Eogt A G 6: 97,134,382 F173L possibly damaging Het
Ephb1 T A 9: 102,194,909 T224S probably benign Het
Fam114a1 A T 5: 64,979,979 E88D possibly damaging Het
Fam84b T C 15: 60,823,714 D61G probably benign Het
Fbn2 A C 18: 58,035,921 M2262R probably null Het
Fsip2 A G 2: 82,985,988 I4022V probably benign Het
Gapvd1 A G 2: 34,684,245 V1301A probably benign Het
Gch1 A T 14: 47,189,266 M1K probably null Het
Hes1 T C 16: 30,067,271 F231S probably damaging Het
Hoxb2 A G 11: 96,351,901 T31A probably benign Het
Ifngr1 T A 10: 19,607,293 V265D probably damaging Het
Ifnl3 A T 7: 28,523,007 I58F probably benign Het
Igf2r T C 17: 12,718,718 T561A probably benign Het
Igfbpl1 T A 4: 45,815,494 H214L probably damaging Het
Irf8 A G 8: 120,755,125 T318A probably benign Het
Kmt2d T C 15: 98,840,020 probably benign Het
Msl2 C T 9: 101,101,975 P516L possibly damaging Het
Naaladl1 A T 19: 6,105,981 I62F probably damaging Het
Neto2 G T 8: 85,670,443 P60Q probably damaging Het
Nipsnap3b A T 4: 53,015,136 H61L possibly damaging Het
Npb T C 11: 120,608,647 F47L probably benign Het
Nutm1 T A 2: 112,248,559 T1004S probably benign Het
Olfr1251 T A 2: 89,667,551 I112F probably benign Het
Olfr1427 A G 19: 12,099,390 V83A probably benign Het
Olfr895 A T 9: 38,268,546 N3I probably damaging Het
Oxr1 C A 15: 41,820,555 A439E probably benign Het
Phf14 A T 6: 12,006,855 K835N probably damaging Het
Prkdc T A 16: 15,815,986 V3518E probably damaging Het
Ptpru T A 4: 131,776,352 E1132D probably damaging Het
Rapgef6 T A 11: 54,676,380 M1129K probably benign Het
Rgmb T C 17: 15,807,786 K224E probably damaging Het
Ryr3 T C 2: 112,686,825 I3318V possibly damaging Het
Slc9a4 A G 1: 40,602,885 Y338C probably damaging Het
Smg5 T C 3: 88,349,269 probably null Het
Tenm3 A T 8: 48,240,479 Y1789* probably null Het
Tgm7 T C 2: 121,093,647 E598G probably damaging Het
Tiam1 C T 16: 89,860,204 probably null Het
Tmem175 A G 5: 108,643,082 N166S probably benign Het
Trp73 G T 4: 154,062,053 N368K probably benign Het
Trpc3 C T 3: 36,638,590 R751H probably damaging Het
Trpm4 C A 7: 45,319,280 A410S probably damaging Het
Ube2t T G 1: 134,971,357 probably null Het
Vmn2r114 C T 17: 23,310,163 A322T probably benign Het
Xylt2 C T 11: 94,667,629 R567H probably benign Het
Zfp119b T C 17: 55,939,137 K318E probably damaging Het
Zfp626 T G 7: 27,818,914 L440R probably damaging Het
Zfp850 A G 7: 27,990,514 S90P possibly damaging Het
Other mutations in Lrrc36
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1509:Lrrc36 UTSW 8 105461129 missense probably damaging 1.00
R1638:Lrrc36 UTSW 8 105449641 missense possibly damaging 0.92
R1800:Lrrc36 UTSW 8 105449765 missense probably damaging 1.00
R2296:Lrrc36 UTSW 8 105461019 missense possibly damaging 0.81
R4030:Lrrc36 UTSW 8 105426807 missense probably damaging 1.00
R4059:Lrrc36 UTSW 8 105427796 missense probably damaging 1.00
R4613:Lrrc36 UTSW 8 105449614 missense possibly damaging 0.95
R4755:Lrrc36 UTSW 8 105452144 missense possibly damaging 0.83
R4786:Lrrc36 UTSW 8 105455278 missense probably benign 0.01
R4828:Lrrc36 UTSW 8 105455230 missense probably benign 0.45
R4911:Lrrc36 UTSW 8 105426935 missense probably benign 0.26
R5135:Lrrc36 UTSW 8 105463898 missense probably benign
R5221:Lrrc36 UTSW 8 105443856 missense probably damaging 0.99
R5354:Lrrc36 UTSW 8 105425364 missense probably damaging 0.99
R5635:Lrrc36 UTSW 8 105457573 missense probably damaging 0.97
R6793:Lrrc36 UTSW 8 105458433 missense probably damaging 1.00
R6986:Lrrc36 UTSW 8 105458447 missense probably damaging 0.99
R7231:Lrrc36 UTSW 8 105461057 missense possibly damaging 0.46
R7326:Lrrc36 UTSW 8 105449769 missense possibly damaging 0.92
R7349:Lrrc36 UTSW 8 105452268 missense probably damaging 1.00
R7728:Lrrc36 UTSW 8 105449498 missense probably benign
R7751:Lrrc36 UTSW 8 105452035 missense possibly damaging 0.83
R8145:Lrrc36 UTSW 8 105443764 missense probably damaging 0.96
R8195:Lrrc36 UTSW 8 105452085 missense possibly damaging 0.90
U24488:Lrrc36 UTSW 8 105449752 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCAGGAAATGATAATGCATCCAC -3'
(R):5'- AAGCAAGTTTCATATGGTTTCCCC -3'

Sequencing Primer
(F):5'- CACTGATCTCTTTTCAGAACTGGTGG -3'
(R):5'- CCTGGAACTCACTGTGTAGATCAG -3'
Posted On2019-07-03