Incidental Mutation 'R6976:Adamts4'
ID568374
Institutional Source Beutler Lab
Gene Symbol Adamts4
Ensembl Gene ENSMUSG00000006403
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 4
Synonymsaggrecanase-1, ADAM-TS4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6976 (G1)
Quality Score76.0075
Status Validated
Chromosome1
Chromosomal Location171250421-171260637 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 171252308 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111314] [ENSMUST00000111315] [ENSMUST00000191871] [ENSMUST00000194778] [ENSMUST00000219033]
Predicted Effect probably benign
Transcript: ENSMUST00000111314
SMART Domains Protein: ENSMUSP00000106946
Gene: ENSMUSG00000006403

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Reprolysin_5 27 214 1.8e-12 PFAM
Pfam:Reprolysin 29 239 1e-19 PFAM
Pfam:Reprolysin_4 33 235 1.2e-10 PFAM
Pfam:Reprolysin_3 50 183 5.4e-12 PFAM
Pfam:Reprolysin_2 50 229 1.9e-9 PFAM
Blast:ACR 240 319 4e-24 BLAST
TSP1 334 386 3.52e-14 SMART
Pfam:ADAM_spacer1 497 614 5.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111315
SMART Domains Protein: ENSMUSP00000106947
Gene: ENSMUSG00000006403

DomainStartEndE-ValueType
signal peptide 1 49 N/A INTRINSIC
Pfam:Pep_M12B_propep 54 177 5.6e-17 PFAM
Pfam:Reprolysin_5 212 399 6.5e-12 PFAM
Pfam:Reprolysin 214 424 4.6e-19 PFAM
Pfam:Reprolysin_4 219 420 4.6e-10 PFAM
Pfam:Reprolysin_3 235 368 1.9e-11 PFAM
Pfam:Reprolysin_2 236 414 7.2e-9 PFAM
Blast:ACR 425 504 4e-24 BLAST
TSP1 519 571 3.52e-14 SMART
Pfam:ADAM_spacer1 682 799 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191871
SMART Domains Protein: ENSMUSP00000141942
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 114 146 5.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194778
SMART Domains Protein: ENSMUSP00000141370
Gene: ENSMUSG00000013593

DomainStartEndE-ValueType
Pfam:Complex1_49kDa 166 231 3.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219033
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active zinc-dependent aggrecanase enzyme that degrades cartilage. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutant mice do not exhibit any morphological abnormalities. However, they do display impaired coordination and an increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,009 probably null Het
Adgrv1 T A 13: 81,520,997 K2480M probably damaging Het
Ankhd1 A C 18: 36,648,254 S2120R probably benign Het
Ash1l T A 3: 88,981,657 V281E possibly damaging Het
Bdh1 G A 16: 31,438,029 A35T probably benign Het
Brpf3 A G 17: 28,835,777 M1098V probably damaging Het
Cel G A 2: 28,556,842 S439F probably damaging Het
Dnah11 T C 12: 118,198,643 S64G probably benign Het
Dpp7 T C 2: 25,354,824 probably null Het
Fam83c T A 2: 155,830,237 Y426F possibly damaging Het
Fasn A G 11: 120,819,867 I322T probably damaging Het
Glod4 A G 11: 76,243,580 F22S probably damaging Het
Gm3127 A G 14: 4,172,441 T231A possibly damaging Het
Gm49383 A G 12: 69,196,956 S444P possibly damaging Het
Gnaz T C 10: 74,991,436 S7P possibly damaging Het
Grin2b C T 6: 135,780,200 S421N probably benign Het
Grm1 T C 10: 10,689,180 D1128G probably benign Het
Hoxb13 A G 11: 96,196,218 T284A probably benign Het
Il9r G A 11: 32,193,177 Q260* probably null Het
Lrrfip1 T A 1: 91,115,015 C381S probably benign Het
Mitd1 A T 1: 37,882,697 D85E probably benign Het
Muc4 G A 16: 32,762,518 D2556N possibly damaging Het
Nlrc4 A G 17: 74,445,939 I483T probably damaging Het
Olfr699 A T 7: 106,790,227 M258K probably damaging Het
Olfr70 A G 4: 43,697,170 M1T probably null Het
Olfr967 A G 9: 39,751,244 N286S probably damaging Het
Pcdhb7 C A 18: 37,343,578 A589E probably benign Het
Pcdhgb5 G A 18: 37,731,268 E39K probably damaging Het
Pja2 T C 17: 64,308,959 K314E probably damaging Het
Plcb1 A G 2: 135,262,239 E276G possibly damaging Het
Ppp2r5c A G 12: 110,544,145 E122G probably damaging Het
Prrc2c A T 1: 162,692,844 N732K probably damaging Het
Rb1cc1 T A 1: 6,262,902 D1348E probably benign Het
Sh3rf1 G T 8: 61,361,732 E442* probably null Het
Snapc1 A G 12: 73,970,200 D204G probably damaging Het
Sry C T Y: 2,662,938 D241N unknown Het
Strn4 T A 7: 16,830,354 M303K probably benign Het
Tas2r118 A G 6: 23,969,471 I197T probably benign Het
Tnni3k A G 3: 154,792,776 Y809H probably benign Het
Tnpo3 A T 6: 29,572,595 C419* probably null Het
Trpm6 T C 19: 18,783,163 S143P probably benign Het
Ttc23l A T 15: 10,537,580 C201* probably null Het
Ubr4 A G 4: 139,393,077 N271S probably damaging Het
Vmn1r70 T C 7: 10,634,044 M134T probably benign Het
Vmn2r27 C T 6: 124,224,353 W215* probably null Het
Xirp1 A T 9: 120,017,918 M633K probably damaging Het
Zfp174 T C 16: 3,847,940 I23T possibly damaging Het
Zfp536 T A 7: 37,480,403 S926C probably damaging Het
Zfp943 T C 17: 21,990,941 S65P possibly damaging Het
Other mutations in Adamts4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Adamts4 APN 1 171252850 missense probably damaging 1.00
IGL02496:Adamts4 APN 1 171250943 missense probably benign 0.00
IGL02510:Adamts4 APN 1 171251390 missense probably benign 0.08
IGL02695:Adamts4 APN 1 171252634 missense probably damaging 1.00
IGL02952:Adamts4 APN 1 171251348 missense probably damaging 1.00
IGL03010:Adamts4 APN 1 171251416 missense probably damaging 1.00
IGL03304:Adamts4 APN 1 171252869 splice site probably benign
PIT4305001:Adamts4 UTSW 1 171259041 missense probably benign
R0331:Adamts4 UTSW 1 171250972 missense probably benign 0.00
R1302:Adamts4 UTSW 1 171253183 missense probably damaging 1.00
R1460:Adamts4 UTSW 1 171256440 splice site probably benign
R1502:Adamts4 UTSW 1 171258990 missense probably damaging 1.00
R1544:Adamts4 UTSW 1 171252742 missense probably benign 0.09
R1815:Adamts4 UTSW 1 171256336 missense probably damaging 0.99
R1982:Adamts4 UTSW 1 171258934 missense probably benign 0.00
R1986:Adamts4 UTSW 1 171256675 missense possibly damaging 0.94
R2281:Adamts4 UTSW 1 171256229 missense probably damaging 1.00
R4261:Adamts4 UTSW 1 171259104 missense probably benign 0.01
R4750:Adamts4 UTSW 1 171251066 missense probably benign
R4868:Adamts4 UTSW 1 171252431 intron probably benign
R4924:Adamts4 UTSW 1 171259074 missense probably damaging 0.97
R5418:Adamts4 UTSW 1 171252574 missense probably damaging 1.00
R5468:Adamts4 UTSW 1 171252609 missense probably benign
R5566:Adamts4 UTSW 1 171250850 start codon destroyed probably null 0.90
R5781:Adamts4 UTSW 1 171251015 missense possibly damaging 0.89
R6043:Adamts4 UTSW 1 171252601 missense probably damaging 1.00
R6053:Adamts4 UTSW 1 171252715 missense possibly damaging 0.85
R6187:Adamts4 UTSW 1 171250993 missense probably damaging 1.00
R6614:Adamts4 UTSW 1 171256624 missense probably benign 0.07
R7291:Adamts4 UTSW 1 171256528 missense probably benign
R7363:Adamts4 UTSW 1 171259039 missense probably benign 0.40
R7490:Adamts4 UTSW 1 171256600 nonsense probably null
R7797:Adamts4 UTSW 1 171257818 missense probably damaging 1.00
X0062:Adamts4 UTSW 1 171256549 missense probably damaging 1.00
Z1176:Adamts4 UTSW 1 171258783 missense probably benign 0.00
Z1176:Adamts4 UTSW 1 171258784 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TAGCTGCTGACTGAATTGTTCC -3'
(R):5'- ATCTACTCAGAGAAGCGAAGC -3'

Sequencing Primer
(F):5'- GAATTGTTCCTCCAACCACACAGTG -3'
(R):5'- GAGGGTCCTGAGATCTCTCTC -3'
Posted On2019-07-11