Mutagenetix > Incidental Mutation

Incidental Mutation 'R7012:Tyw1'

568381

Institutional Source

Beutler Lab

Gene Symbol

Tyw1

Ensembl Gene

ENSMUSG00000056310

Gene Name

tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)

Synonyms

Rsafd1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7012 (G1)

Quality Score

144.008

Status

Validated

Chromosome

Chromosomal Location

130255619-130341563 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to G at 130277730 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000098226 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040213] [ENSMUST00000044204] [ENSMUST00000100662]

AlphaFold

Q8BJM7

Predicted Effect

probably benign
Transcript: ENSMUST00000040213

SMART Domains

Protein: ENSMUSP00000037173
Gene: ENSMUSG00000056310

Domain	Start	End	E-Value	Type
transmembrane domain	20	39	N/A	INTRINSIC
Pfam:Flavodoxin_1	73	224	1.6e-27	PFAM
low complexity region	276	288	N/A	INTRINSIC
Pfam:Radical_SAM	399	581	1.1e-29	PFAM
Pfam:Wyosine_form	583	646	3.6e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000044204

SMART Domains

Protein: ENSMUSP00000047318
Gene: ENSMUSG00000056310

Domain	Start	End	E-Value	Type
transmembrane domain	20	39	N/A	INTRINSIC
Pfam:Flavodoxin_1	73	224	1.5e-27	PFAM
low complexity region	276	288	N/A	INTRINSIC
transmembrane domain	375	397	N/A	INTRINSIC
transmembrane domain	423	445	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000100662

SMART Domains

Protein: ENSMUSP00000098226
Gene: ENSMUSG00000056310

Domain	Start	End	E-Value	Type
transmembrane domain	20	39	N/A	INTRINSIC
Pfam:Flavodoxin_1	73	224	4.9e-28	PFAM
low complexity region	276	288	N/A	INTRINSIC
low complexity region	319	332	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Wybutosine (yW) is a hypermodified guanosine found in phenylalanine tRNA adjacent to the anticodon that stabilizes codon-anticodon interactions in the ribosome. In yeast, the homolog of this gene is essential for the synthesis of wybutosine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	T	C	5: 35,612,087	F686L	probably benign	Het
Adcy4	C	T	14: 55,779,919	V266I	possibly damaging	Het
Adgrb1	A	G	15: 74,529,901	T249A	probably damaging	Het
Adssl1	A	G	12: 112,634,236	D213G	probably benign	Het
Ap1b1	T	G	11: 5,030,963	V453G	probably damaging	Het
Apold1	G	A	6: 134,984,044	G154R	probably damaging	Het
Birc5	A	G	11: 117,849,436	E29G	probably benign	Het
Clcn1	G	A	6: 42,290,608	R75H	probably benign	Het
Cngb1	T	A	8: 95,257,955	I868F	possibly damaging	Het
Cntn6	T	A	6: 104,726,262	V215E	probably damaging	Het
Cntn6	A	G	6: 104,774,480	I294V	probably benign	Het
Col6a2	A	T	10: 76,614,677	I140N	possibly damaging	Het
Cops5	A	G	1: 10,030,665	*147Q	probably null	Het
Dbr1	T	A	9: 99,583,321	Y317*	probably null	Het
Dock5	A	C	14: 67,822,586	V468G	probably damaging	Het
F13b	A	G	1: 139,516,358	I477V	probably benign	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Git1	T	C	11: 77,499,780	L114P	probably damaging	Het
Greb1l	G	T	18: 10,529,707		probably null	Het
Itih4	A	G	14: 30,890,749	N244S	probably benign	Het
Lin28a	A	G	4: 134,018,729	S5P	probably damaging	Het
Lipt1	T	C	1: 37,875,979	I372T	probably benign	Het
Lysmd4	A	G	7: 67,226,017	T143A	probably benign	Het
Muc16	T	C	9: 18,495,618		probably null	Het
Olfr1101	A	T	2: 86,988,707	H156Q	possibly damaging	Het
Olfr1393	A	T	11: 49,280,996	M283L	probably benign	Het
Olfr271-ps1	A	G	4: 52,936,193	L30P	probably damaging	Het
Olfr49	A	G	14: 54,282,217	I226T	possibly damaging	Het
Pclo	G	A	5: 14,750,479	G4438D	unknown	Het
Phlpp2	T	A	8: 109,876,854	F51I	possibly damaging	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rxfp2	T	C	5: 150,081,194	V711A	probably benign	Het
Sbno2	A	T	10: 80,069,518		probably benign	Het
Setd2	T	A	9: 110,547,683	S189T	probably damaging	Het
Sez6	A	G	11: 77,977,795	N965S	probably benign	Het
Sh3d19	A	G	3: 86,085,013	N116S	probably benign	Het
Slc43a3	T	C	2: 84,946,969	Y221H	probably damaging	Het
Slco1a6	T	C	6: 142,086,561	I613V	probably benign	Het
Stag3	T	A	5: 138,297,609		probably null	Het
Ston1	T	C	17: 88,635,985	M273T	probably damaging	Het
Tbc1d32	A	T	10: 56,224,724	Y53N	probably damaging	Het
Tmem132b	T	A	5: 125,698,590	L376Q	probably damaging	Het
Trim60	A	G	8: 65,000,391	V402A	possibly damaging	Het
Tssk5	A	C	15: 76,373,545	N178K	probably damaging	Het
Ttll9	T	C	2: 153,003,062	I450T	possibly damaging	Het
Usp16	T	C	16: 87,458,744		probably null	Het
Vmn2r97	T	C	17: 18,947,494	V670A	probably damaging	Het
Vmn2r98	A	G	17: 19,066,268	N343D	probably benign	Het
Zfp472	T	G	17: 32,977,246	N98K	probably benign	Het

Other mutations in Tyw1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02329:Tyw1	APN	5	130267080	missense	probably benign	0.20
IGL02873:Tyw1	APN	5	130335330	missense	probably benign	0.00
IGL02879:Tyw1	APN	5	130296771	missense	probably damaging	1.00
IGL03080:Tyw1	APN	5	130267055	missense	probably damaging	1.00
IGL03291:Tyw1	APN	5	130299993	missense	probably damaging	1.00
IGL03297:Tyw1	APN	5	130340734	missense	probably damaging	1.00
remnant	UTSW	5	130262921	missense	probably damaging	0.99
schimmel	UTSW	5	130269224	missense	probably damaging	1.00
tyrone	UTSW	5	130296679	nonsense	probably null
yang	UTSW	5	130259035	missense	probably damaging	0.98
R1420:Tyw1	UTSW	5	130274745	critical splice donor site	probably null
R1650:Tyw1	UTSW	5	130288911	missense	possibly damaging	0.91
R1674:Tyw1	UTSW	5	130269328	missense	probably benign	0.01
R1789:Tyw1	UTSW	5	130258993	missense	probably damaging	0.99
R1996:Tyw1	UTSW	5	130262811	splice site	probably benign
R2421:Tyw1	UTSW	5	130269260	missense	probably damaging	1.00
R3913:Tyw1	UTSW	5	130259035	missense	probably damaging	0.98
R4412:Tyw1	UTSW	5	130335232	splice site	probably null
R4835:Tyw1	UTSW	5	130277058	missense	probably benign
R5058:Tyw1	UTSW	5	130277086	missense	probably benign	0.03
R5190:Tyw1	UTSW	5	130267915	nonsense	probably null
R5398:Tyw1	UTSW	5	130277157	intron	probably benign
R5459:Tyw1	UTSW	5	130274706	missense	probably damaging	1.00
R5597:Tyw1	UTSW	5	130274657	missense	probably benign	0.00
R5704:Tyw1	UTSW	5	130282022	nonsense	probably null
R5825:Tyw1	UTSW	5	130268088	missense	probably damaging	0.99
R5887:Tyw1	UTSW	5	130325699	missense	probably damaging	1.00
R6072:Tyw1	UTSW	5	130267911	missense	possibly damaging	0.92
R6349:Tyw1	UTSW	5	130277031	missense	possibly damaging	0.82
R6366:Tyw1	UTSW	5	130281951	unclassified	probably benign
R7259:Tyw1	UTSW	5	130267872	splice site	probably null
R7328:Tyw1	UTSW	5	130262844	missense	probably benign	0.08
R7555:Tyw1	UTSW	5	130274706	missense	probably damaging	1.00
R8006:Tyw1	UTSW	5	130268072	missense	possibly damaging	0.87
R8171:Tyw1	UTSW	5	130300014	missense	probably benign	0.19
R8196:Tyw1	UTSW	5	130300021	missense	probably damaging	1.00
R8714:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R8715:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R8716:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R8970:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R8992:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9117:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9119:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9120:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9172:Tyw1	UTSW	5	130296679	nonsense	probably null
R9204:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9205:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9207:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9325:Tyw1	UTSW	5	130262921	missense	probably damaging	0.99
R9364:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9368:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9369:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9470:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9471:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9566:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00
R9567:Tyw1	UTSW	5	130269224	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCACCGATATGGATGGACC -3'
(R):5'- CAAGACCCTAGCAACAGTGAGG -3'

Sequencing Primer
(F):5'- TGGATGGACCAGTGTACCCAAC -3'
(R):5'- CCCTAGCAACAGTGAGGAGGTTC -3'

Posted On

2019-07-11