Mutagenetix > Incidental Mutations

Incidental Mutation 'R7046:Cnga1'

568389

Institutional Source

Beutler Lab

Gene Symbol

Cnga1

Ensembl Gene

ENSMUSG00000067220

Gene Name

cyclic nucleotide gated channel alpha 1

Synonyms

Cncg

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.309) question?

Stock #

R7046 (G1)

Quality Score

155.008

Status

Validated

Chromosome

Chromosomal Location

72603696-72644275 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 72629353 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000132329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087213] [ENSMUST00000126799] [ENSMUST00000135701] [ENSMUST00000169997]

Predicted Effect

probably benign
Transcript: ENSMUST00000087213

SMART Domains

Protein: ENSMUSP00000084464
Gene: ENSMUSG00000067220

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000126799

Predicted Effect

probably benign
Transcript: ENSMUST00000135701

Predicted Effect

probably benign
Transcript: ENSMUST00000169997

SMART Domains

Protein: ENSMUSP00000132329
Gene: ENSMUSG00000067220

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	194	388	4.7e-19	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	T	C	7: 46,122,940	Y805C	probably damaging	Het
Cabp7	T	A	11: 4,738,886	I195F	probably damaging	Het
Camsap1	T	C	2: 25,945,189	N317S	probably damaging	Het
Ccdc127	T	G	13: 74,352,875	L4V	probably damaging	Het
Ccdc7a	T	C	8: 129,047,619	E145G	probably damaging	Het
Cdh10	T	A	15: 19,013,201	V629D	probably damaging	Het
Cdh23	A	C	10: 60,378,751	L1497R	probably damaging	Het
Chsy3	A	G	18: 59,409,803	K671R	probably benign	Het
Clca4b	T	C	3: 144,915,606	Y569C	probably damaging	Het
Cyp51	T	A	5: 4,100,188	E178D	probably damaging	Het
Defa30	T	A	8: 21,135,455	N78K	probably benign	Het
Disp1	C	A	1: 183,087,466	R1130L	probably damaging	Het
Dnah14	G	T	1: 181,623,003	C727F	probably benign	Het
Egf	A	T	3: 129,754,958	W3R	unknown	Het
Egfem1	G	A	3: 29,082,215		probably null	Het
Epb41l1	G	T	2: 156,526,892	V682L	possibly damaging	Het
Etv1	A	G	12: 38,784,370		probably null	Het
Faap100	A	G	11: 120,377,374	F191S	possibly damaging	Het
Fam208a	A	T	14: 27,472,435	L1197F	probably damaging	Het
Fmo1	T	A	1: 162,839,694	D184V	possibly damaging	Het
Ghrl	A	G	6: 113,719,383	L16P	probably damaging	Het
Gria4	T	A	9: 4,420,278	L861F	probably damaging	Het
Gsr	T	A	8: 33,695,062	M428K	probably damaging	Het
Hspa5	C	T	2: 34,773,192	P127L	probably damaging	Het
Kbtbd12	A	G	6: 88,618,515	M111T	possibly damaging	Het
Krtap21-1	G	T	16: 89,403,735	Y6*	probably null	Het
Lin9	A	G	1: 180,667,370	D219G	probably damaging	Het
Lrrc38	A	G	4: 143,350,169	M1V	probably null	Het
Macc1	T	G	12: 119,447,038	F514V	probably benign	Het
Madcam1	C	T	10: 79,668,305	R242C	probably benign	Het
Mfhas1	T	C	8: 35,664,790	S1037P	probably benign	Het
Micall2	C	T	5: 139,708,944		probably benign	Het
Mtr	C	A	13: 12,190,209	A1122S	possibly damaging	Het
Muc6	T	A	7: 141,640,189		probably benign	Het
Myh15	T	A	16: 49,109,299	C529*	probably null	Het
Napsa	T	C	7: 44,585,085	V247A	probably damaging	Het
Nr2c2	A	G	6: 92,158,357	T309A	probably damaging	Het
Olfr133	A	T	17: 38,148,800	M71L	probably benign	Het
Olfr357	T	A	2: 36,997,161	V117E	probably benign	Het
Olfr385	A	T	11: 73,589,732	I2K	probably benign	Het
Osgepl1	A	T	1: 53,321,551	I384F	possibly damaging	Het
Otud4	C	T	8: 79,651,042	L111F	possibly damaging	Het
Pds5b	A	G	5: 150,749,920	Y481C	probably damaging	Het
Pdzrn4	T	A	15: 92,770,422	Y818*	probably null	Het
Pin1rt1	T	C	2: 104,714,422	S122G	probably benign	Het
Pkdcc	A	T	17: 83,224,258	Y487F	probably damaging	Het
Plxna4	C	T	6: 32,516,505	C392Y	probably damaging	Het
Psd4	T	G	2: 24,394,973	M283R	probably benign	Het
Ralgds	G	T	2: 28,540,729	G68W	probably damaging	Het
Rmdn2	T	A	17: 79,621,379	I20N	probably damaging	Het
Sestd1	A	G	2: 77,192,566	V486A	probably benign	Het
Svs1	T	A	6: 48,987,578	D173E	probably benign	Het
Tango6	A	G	8: 106,807,116	H958R	possibly damaging	Het
Taok3	C	T	5: 117,273,706	R857C	probably damaging	Het
Theg	G	T	10: 79,586,962	D35E	probably benign	Het
Trio	T	C	15: 27,832,051	E1245G	probably damaging	Het
Usp19	C	T	9: 108,497,135	H763Y	possibly damaging	Het
Vmn1r185	A	G	7: 26,611,226	S285P	probably damaging	Het
Vmn1r45	T	G	6: 89,933,556	Y144S	probably benign	Het
Vwa3b	G	A	1: 37,173,878	E152K	probably benign	Het
Wdr61	T	A	9: 54,719,255	D275V	probably damaging	Het
Xrcc5	G	A	1: 72,394,716	M731I	probably benign	Het
Zfp619	G	A	7: 39,537,363	S939N	possibly damaging	Het
Zfp874a	C	A	13: 67,442,299	C422F	probably damaging	Het
Zfp948	A	G	17: 21,588,457	D637G	possibly damaging	Het

Other mutations in Cnga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02332:Cnga1	APN	5	72604486	missense	probably damaging	1.00
IGL02345:Cnga1	APN	5	72605272	missense	probably benign	0.00
IGL02354:Cnga1	APN	5	72616718	splice site	probably null
IGL02361:Cnga1	APN	5	72616718	splice site	probably null
IGL03025:Cnga1	APN	5	72605413	missense	probably benign
IGL03257:Cnga1	APN	5	72610862	missense	probably damaging	1.00
IGL03046:Cnga1	UTSW	5	72604338	missense	probably benign	0.01
R0238:Cnga1	UTSW	5	72605031	missense	probably damaging	0.97
R0238:Cnga1	UTSW	5	72605031	missense	probably damaging	0.97
R0352:Cnga1	UTSW	5	72604503	missense	possibly damaging	0.95
R1292:Cnga1	UTSW	5	72604683	missense	probably damaging	1.00
R1386:Cnga1	UTSW	5	72612183	nonsense	probably null
R1903:Cnga1	UTSW	5	72616725	missense	possibly damaging	0.94
R2096:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2097:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2101:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2276:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2279:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2507:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R2508:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R3005:Cnga1	UTSW	5	72605107	missense	probably damaging	1.00
R3779:Cnga1	UTSW	5	72604783	missense	probably damaging	1.00
R4357:Cnga1	UTSW	5	72618252	missense	probably damaging	1.00
R4399:Cnga1	UTSW	5	72604381	missense	probably damaging	0.98
R4615:Cnga1	UTSW	5	72604774	missense	probably damaging	1.00
R4946:Cnga1	UTSW	5	72604764	missense	probably damaging	1.00
R5229:Cnga1	UTSW	5	72609500	missense	probably damaging	1.00
R5474:Cnga1	UTSW	5	72605193	missense	probably damaging	1.00
R5566:Cnga1	UTSW	5	72618250	missense	probably damaging	0.98
R5754:Cnga1	UTSW	5	72605272	missense	probably benign	0.00
R5899:Cnga1	UTSW	5	72619061	missense	possibly damaging	0.85
R5906:Cnga1	UTSW	5	72610858	missense	probably benign	0.19
R5954:Cnga1	UTSW	5	72604878	missense	probably damaging	0.99
R5997:Cnga1	UTSW	5	72604575	missense	probably damaging	0.98
R6087:Cnga1	UTSW	5	72610812	missense	probably damaging	1.00
R6365:Cnga1	UTSW	5	72604945	missense	probably benign	0.00
R6391:Cnga1	UTSW	5	72612359	critical splice donor site	probably null
R6525:Cnga1	UTSW	5	72618231	missense	probably damaging	1.00
R7229:Cnga1	UTSW	5	72618249	missense	probably benign
R7299:Cnga1	UTSW	5	72605432	missense	probably benign	0.20
R7367:Cnga1	UTSW	5	72605358	missense	possibly damaging	0.75
R7425:Cnga1	UTSW	5	72609525	missense	probably benign	0.12
R7449:Cnga1	UTSW	5	72605304	missense	probably benign	0.29
R7538:Cnga1	UTSW	5	72612380	missense	probably benign	0.24
X0062:Cnga1	UTSW	5	72604485	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCAAAGGAAATGAGGAATCTGA -3'
(R):5'- AGCTAGAAGTGGAGTCTGGGAT -3'

Sequencing Primer
(F):5'- ACTTGTCTAATCTAGGCGAGCAGC -3'
(R):5'- TGAAGGTAGGAGCTTTCAAACAAC -3'

Posted On

2019-07-16