Mutagenetix > Incidental Mutations

Incidental Mutation 'R7046:Etv1'

568391

Institutional Source

Beutler Lab

Gene Symbol

Etv1

Ensembl Gene

ENSMUSG00000004151

Gene Name

ets variant 1

Synonyms

Etsrp81, ER81

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.467) question?

Stock #

R7046 (G1)

Quality Score

135.008

Status

Validated

Chromosome

Chromosomal Location

38779380-38870484 bp(+) (GRCm38)

Type of Mutation

splice site (568 bp from exon)

DNA Base Change (assembly)

A to G at 38784370 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124736 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095767] [ENSMUST00000159334] [ENSMUST00000160244] [ENSMUST00000160701] [ENSMUST00000160856] [ENSMUST00000160996] [ENSMUST00000161164] [ENSMUST00000161513] [ENSMUST00000161980] [ENSMUST00000162563]

AlphaFold

P41164

Predicted Effect

probably benign
Transcript: ENSMUST00000095767

SMART Domains

Protein: ENSMUSP00000093442
Gene: ENSMUSG00000004151

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	1	333	5e-153	PFAM
ETS	334	419	1.72e-57	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000159334

SMART Domains

Protein: ENSMUSP00000125676
Gene: ENSMUSG00000004151

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	16	293	1.1e-112	PFAM
ETS	294	379	1.72e-57	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160244

SMART Domains

Protein: ENSMUSP00000125733
Gene: ENSMUSG00000004151

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	1	310	2.5e-133	PFAM
ETS	311	396	1.72e-57	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000160701

SMART Domains

Protein: ENSMUSP00000124019
Gene: ENSMUSG00000004151

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	14	82	1.4e-30	PFAM
Pfam:ETS_PEA3_N	80	230	1.6e-68	PFAM
ETS	231	316	1.72e-57	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160856

SMART Domains

Protein: ENSMUSP00000125692
Gene: ENSMUSG00000004151

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	1	315	3.8e-130	PFAM
ETS	316	401	1.72e-57	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160996

SMART Domains

Protein: ENSMUSP00000124705
Gene: ENSMUSG00000004151

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	1	230	1.9e-85	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161164

Predicted Effect

probably benign
Transcript: ENSMUST00000161513

SMART Domains

Protein: ENSMUSP00000124166
Gene: ENSMUSG00000004151

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	23	210	8.5e-71	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000161980

SMART Domains

Protein: ENSMUSP00000124736
Gene: ENSMUSG00000004151

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	10	275	3.2e-104	PFAM
ETS	276	361	1.72e-57	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162563

SMART Domains

Protein: ENSMUSP00000125157
Gene: ENSMUSG00000004151

Domain	Start	End	E-Value	Type
Pfam:ETS_PEA3_N	1	333	5.6e-150	PFAM
ETS	334	419	1.72e-57	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ETS (E twenty-six) family of transcription factors. The ETS proteins regulate many target genes that modulate biological processes like cell growth, angiogenesis, migration, proliferation and differentiation. All ETS proteins contain an ETS DNA-binding domain that binds to DNA sequences containing the consensus 5'-CGGA[AT]-3'. The protein encoded by this gene contains a conserved short acidic transactivation domain (TAD) in the N-terminal region, in addition to the ETS DNA-binding domain in the C-terminal region. This gene is involved in chromosomal translocations, which result in multiple fusion proteins including EWS-ETV1 in Ewing sarcoma and at least 10 ETV1 partners (see PMID: 19657377, Table 1) in prostate cancer. In addition to chromosomal rearrangement, this gene is overexpressed in prostate cancer, melanoma and gastrointestinal stromal tumor. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to premature death, ataxia, impaired limb coordination, defects in muscle innervation, muscle spindle differentiation and sensory-motor connectivity, deficient golgi tendon organs, and absence of Pacinian corpuscles and their afferents. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	T	C	7: 46,122,940	Y805C	probably damaging	Het
Cabp7	T	A	11: 4,738,886	I195F	probably damaging	Het
Camsap1	T	C	2: 25,945,189	N317S	probably damaging	Het
Ccdc127	T	G	13: 74,352,875	L4V	probably damaging	Het
Ccdc7a	T	C	8: 129,047,619	E145G	probably damaging	Het
Cdh10	T	A	15: 19,013,201	V629D	probably damaging	Het
Cdh23	A	C	10: 60,378,751	L1497R	probably damaging	Het
Chsy3	A	G	18: 59,409,803	K671R	probably benign	Het
Clca4b	T	C	3: 144,915,606	Y569C	probably damaging	Het
Cnga1	T	C	5: 72,629,353		probably benign	Het
Cyp51	T	A	5: 4,100,188	E178D	probably damaging	Het
Defa30	T	A	8: 21,135,455	N78K	probably benign	Het
Disp1	C	A	1: 183,087,466	R1130L	probably damaging	Het
Dnah14	G	T	1: 181,623,003	C727F	probably benign	Het
Egf	A	T	3: 129,754,958	W3R	unknown	Het
Egfem1	G	A	3: 29,082,215		probably null	Het
Epb41l1	G	T	2: 156,526,892	V682L	possibly damaging	Het
Faap100	A	G	11: 120,377,374	F191S	possibly damaging	Het
Fam208a	A	T	14: 27,472,435	L1197F	probably damaging	Het
Fmo1	T	A	1: 162,839,694	D184V	possibly damaging	Het
Ghrl	A	G	6: 113,719,383	L16P	probably damaging	Het
Gria4	T	A	9: 4,420,278	L861F	probably damaging	Het
Gsr	T	A	8: 33,695,062	M428K	probably damaging	Het
Hspa5	C	T	2: 34,773,192	P127L	probably damaging	Het
Kbtbd12	A	G	6: 88,618,515	M111T	possibly damaging	Het
Krtap21-1	G	T	16: 89,403,735	Y6*	probably null	Het
Lin9	A	G	1: 180,667,370	D219G	probably damaging	Het
Lrrc38	A	G	4: 143,350,169	M1V	probably null	Het
Macc1	T	G	12: 119,447,038	F514V	probably benign	Het
Madcam1	C	T	10: 79,668,305	R242C	probably benign	Het
Mfhas1	T	C	8: 35,664,790	S1037P	probably benign	Het
Micall2	C	T	5: 139,708,944		probably benign	Het
Mtr	C	A	13: 12,190,209	A1122S	possibly damaging	Het
Muc6	T	A	7: 141,640,189		probably benign	Het
Myh15	T	A	16: 49,109,299	C529*	probably null	Het
Napsa	T	C	7: 44,585,085	V247A	probably damaging	Het
Nr2c2	A	G	6: 92,158,357	T309A	probably damaging	Het
Olfr133	A	T	17: 38,148,800	M71L	probably benign	Het
Olfr357	T	A	2: 36,997,161	V117E	probably benign	Het
Olfr385	A	T	11: 73,589,732	I2K	probably benign	Het
Osgepl1	A	T	1: 53,321,551	I384F	possibly damaging	Het
Otud4	C	T	8: 79,651,042	L111F	possibly damaging	Het
Pds5b	A	G	5: 150,749,920	Y481C	probably damaging	Het
Pdzrn4	T	A	15: 92,770,422	Y818*	probably null	Het
Pin1rt1	T	C	2: 104,714,422	S122G	probably benign	Het
Pkdcc	A	T	17: 83,224,258	Y487F	probably damaging	Het
Plxna4	C	T	6: 32,516,505	C392Y	probably damaging	Het
Psd4	T	G	2: 24,394,973	M283R	probably benign	Het
Ralgds	G	T	2: 28,540,729	G68W	probably damaging	Het
Rmdn2	T	A	17: 79,621,379	I20N	probably damaging	Het
Sestd1	A	G	2: 77,192,566	V486A	probably benign	Het
Svs1	T	A	6: 48,987,578	D173E	probably benign	Het
Tango6	A	G	8: 106,807,116	H958R	possibly damaging	Het
Taok3	C	T	5: 117,273,706	R857C	probably damaging	Het
Theg	G	T	10: 79,586,962	D35E	probably benign	Het
Trio	T	C	15: 27,832,051	E1245G	probably damaging	Het
Usp19	C	T	9: 108,497,135	H763Y	possibly damaging	Het
Vmn1r185	A	G	7: 26,611,226	S285P	probably damaging	Het
Vmn1r45	T	G	6: 89,933,556	Y144S	probably benign	Het
Vwa3b	G	A	1: 37,173,878	E152K	probably benign	Het
Wdr61	T	A	9: 54,719,255	D275V	probably damaging	Het
Xrcc5	G	A	1: 72,394,716	M731I	probably benign	Het
Zfp619	G	A	7: 39,537,363	S939N	possibly damaging	Het
Zfp874a	C	A	13: 67,442,299	C422F	probably damaging	Het
Zfp948	A	G	17: 21,588,457	D637G	possibly damaging	Het

Other mutations in Etv1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Etv1	APN	12	38781792	splice site	probably benign
IGL01376:Etv1	APN	12	38857040	missense	probably damaging	1.00
IGL01387:Etv1	APN	12	38861327	missense	probably damaging	0.99
IGL01936:Etv1	APN	12	38835061	splice site	probably benign
IGL02388:Etv1	APN	12	38781799	missense	possibly damaging	0.62
IGL02933:Etv1	APN	12	38781833	missense	probably benign	0.22
R0844:Etv1	UTSW	12	38861354	missense	probably damaging	1.00
R0993:Etv1	UTSW	12	38827864	missense	probably damaging	1.00
R1187:Etv1	UTSW	12	38865564	missense	probably damaging	1.00
R1710:Etv1	UTSW	12	38852262	missense	probably benign	0.18
R2094:Etv1	UTSW	12	38835116	missense	probably null	1.00
R2879:Etv1	UTSW	12	38783810	splice site	probably null
R3607:Etv1	UTSW	12	38831086	missense	probably damaging	1.00
R4353:Etv1	UTSW	12	38857106	missense	probably damaging	1.00
R4646:Etv1	UTSW	12	38865686	missense	possibly damaging	0.94
R4678:Etv1	UTSW	12	38835220	missense	probably damaging	1.00
R4768:Etv1	UTSW	12	38827793	missense	probably damaging	1.00
R4812:Etv1	UTSW	12	38861288	missense	probably damaging	1.00
R4877:Etv1	UTSW	12	38831293	splice site	probably null
R5024:Etv1	UTSW	12	38854234	splice site	probably null
R5253:Etv1	UTSW	12	38852249	missense	possibly damaging	0.50
R5936:Etv1	UTSW	12	38835210	missense	probably damaging	1.00
R6085:Etv1	UTSW	12	38854195	missense	probably damaging	1.00
R6167:Etv1	UTSW	12	38865641	missense	possibly damaging	0.88
R6709:Etv1	UTSW	12	38783797	missense	possibly damaging	0.93
R7243:Etv1	UTSW	12	38857046	missense	probably benign	0.36
R7616:Etv1	UTSW	12	38865606	missense	probably damaging	1.00
R8230:Etv1	UTSW	12	38780936	start codon destroyed	probably null	1.00
R9021:Etv1	UTSW	12	38780972	missense	probably benign	0.01
R9182:Etv1	UTSW	12	38780717	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAGCGTGACCCATTCTGATATG -3'
(R):5'- CACATAGCCTGCAACTTGGC -3'

Sequencing Primer
(F):5'- CGTGACCCATTCTGATATGCTTAAGG -3'
(R):5'- CAGAACCTCTGCCAATTTTTACAG -3'

Posted On

2019-07-16