Incidental Mutation 'R7009:Cacna2d3'
ID568393
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Namecalcium channel, voltage-dependent, alpha2/delta subunit 3
Synonymsalpha2delta3, alpha 2 delta-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7009 (G1)
Quality Score58.0073
Status Validated
Chromosome14
Chromosomal Location28904943-29721864 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 28969365 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000152967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567] [ENSMUST00000225668] [ENSMUST00000225985]
Predicted Effect probably benign
Transcript: ENSMUST00000022567
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000225668
AA Change: M1K
Predicted Effect probably null
Transcript: ENSMUST00000225985
AA Change: M1K
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,784,520 D193V probably damaging Het
4921517D22Rik G T 13: 59,690,810 D69E possibly damaging Het
Abat A C 16: 8,602,367 M177L probably benign Het
Acadvl A G 11: 70,014,791 probably null Het
Adam5 T C 8: 24,806,438 N331S probably benign Het
Ager A G 17: 34,600,736 E372G probably damaging Het
Angpt1 T A 15: 42,523,595 Q121L possibly damaging Het
Apoa4 A T 9: 46,242,880 I260F possibly damaging Het
Arhgap32 A T 9: 32,245,976 I90F probably damaging Het
Arhgap5 A T 12: 52,519,639 Q1131L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc18 G A 5: 108,173,862 probably null Het
Ccdc42 T C 11: 68,594,616 F267S probably damaging Het
Cdh23 T A 10: 60,337,306 Y1700F probably damaging Het
Cenpe G A 3: 135,235,202 S704N probably benign Het
Cenpe A T 3: 135,235,201 S704C probably damaging Het
Cfap54 A T 10: 92,875,019 S2727T unknown Het
Clu T A 14: 65,971,832 V113D probably damaging Het
Cnbd2 A G 2: 156,320,034 I98V probably benign Het
Copa G T 1: 172,091,000 R97L probably damaging Het
Epb41l1 C A 2: 156,534,683 probably null Het
Etnk1 T A 6: 143,203,154 probably null Het
Fnip1 A T 11: 54,502,935 K732N probably damaging Het
G6pd2 A G 5: 61,808,891 E3G probably benign Het
Gal3st2 A G 1: 93,873,759 T95A probably benign Het
Gapvd1 A G 2: 34,700,817 S948P probably damaging Het
Ggps1 A T 13: 14,054,165 Y8* probably null Het
Gria2 T C 3: 80,706,972 E587G probably damaging Het
Hpse T C 5: 100,692,279 E324G probably benign Het
Il16 G A 7: 83,646,388 T493I probably benign Het
Ints1 T C 5: 139,768,462 T652A possibly damaging Het
Ism1 A G 2: 139,757,279 I391V probably damaging Het
Katnb1 A G 8: 95,098,384 D598G probably damaging Het
Kif5c A G 2: 49,757,429 S880G probably benign Het
Klra8 T C 6: 130,125,184 N96S probably benign Het
Krt79 T A 15: 101,931,441 D373V probably damaging Het
Lamtor4 G A 5: 138,259,112 R92Q probably benign Het
Lce1d C A 3: 92,686,046 C20F unknown Het
Limk1 T C 5: 134,672,699 T117A probably benign Het
Medag A T 5: 149,427,243 K61M probably benign Het
Mkrn3 T C 7: 62,419,618 M142V probably benign Het
Mob3c G A 4: 115,831,582 R104H probably benign Het
Morc1 G T 16: 48,627,070 R903L possibly damaging Het
Myh6 T C 14: 54,952,292 E1099G probably damaging Het
Nphp3 T G 9: 104,016,116 C434G probably null Het
Npr3 C T 15: 11,905,248 C131Y probably damaging Het
Oacyl C A 18: 65,722,538 Y112* probably null Het
Oprl1 A G 2: 181,718,381 T77A probably damaging Het
Osgep A G 14: 50,924,708 V24A probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
Pdcd11 T C 19: 47,113,142 L922P probably benign Het
Phldb1 A G 9: 44,694,408 V375A probably damaging Het
Pip5k1b C T 19: 24,359,935 probably null Het
Psmd3 G A 11: 98,682,766 D13N probably benign Het
Ptprc G A 1: 138,064,553 H1140Y probably damaging Het
Ranbp3l A T 15: 9,062,984 H291L probably damaging Het
Rasa4 T A 5: 136,101,363 D324E probably damaging Het
Rilpl1 T A 5: 124,503,692 silent Het
Rin2 A C 2: 145,883,475 D794A probably damaging Het
Ripk1 A G 13: 34,030,062 I522M probably damaging Het
Rnf31 T C 14: 55,592,551 Y143H probably benign Het
Rp1 T G 1: 4,042,068 I1187L unknown Het
Rps6ka5 G A 12: 100,619,537 H166Y probably damaging Het
Rrm1 T C 7: 102,460,334 V455A probably damaging Het
Runx2 G A 17: 44,814,192 P80L probably damaging Het
Scn5a T G 9: 119,485,930 E1904A probably damaging Het
Sec16a G T 2: 26,436,002 S240* probably null Het
Slc22a8 C T 19: 8,605,417 T154I probably benign Het
Slc25a16 T A 10: 62,937,454 V156E possibly damaging Het
Slc28a3 A T 13: 58,610,804 S2T probably benign Het
Srd5a3 G A 5: 76,149,866 V48I probably benign Het
Srebf1 A C 11: 60,200,526 H1025Q probably damaging Het
Stard9 A G 2: 120,697,191 K1310E probably benign Het
Swt1 A G 1: 151,370,630 V848A possibly damaging Het
Tanc2 A T 11: 105,840,699 T434S possibly damaging Het
Tcf20 G A 15: 82,854,682 T856I probably benign Het
Tcf7l2 T C 19: 55,894,733 probably null Het
Tmem246 A T 4: 49,586,325 M281K probably benign Het
Trim45 A G 3: 100,931,879 probably benign Het
Tsen2 T A 6: 115,547,972 M44K possibly damaging Het
Ttc21a T A 9: 119,958,073 C715* probably null Het
Vmn2r102 G A 17: 19,694,194 V674I probably damaging Het
Zfp87 A G 13: 67,517,054 S430P probably damaging Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29300731 splice site probably benign
IGL01150:Cacna2d3 APN 14 29183641 missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28943591 missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28943607 missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 29063875 unclassified probably benign
IGL02237:Cacna2d3 APN 14 29346997 missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28956870 splice site probably null
IGL02604:Cacna2d3 APN 14 29293109 missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29351950 splice site probably null
IGL02838:Cacna2d3 APN 14 29300828 critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 29064319 critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 29058431 missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29467952 missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28952286 missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29300748 missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29720877 nonsense probably null
R0094:Cacna2d3 UTSW 14 29170503 critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 29045644 missense probably damaging 0.96
R0485:Cacna2d3 UTSW 14 29534519 missense possibly damaging 0.89
R0669:Cacna2d3 UTSW 14 29467949 missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28982365 missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 29058628 missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 29045623 missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 29064321 splice site probably benign
R1312:Cacna2d3 UTSW 14 29045668 missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29333779 missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28981180 missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28972242 missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29351822 missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28969214 missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28905302 missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 29063918 missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29346923 missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 29183581 missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R3850:Cacna2d3 UTSW 14 29347120 critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 29103713 missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28982346 missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29293135 missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28956786 splice site probably null
R4965:Cacna2d3 UTSW 14 28982332 missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29293178 missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29347030 missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28943555 critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29720934 missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29396489 missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28908321 missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29396565 missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 29064186 unclassified probably benign
R6632:Cacna2d3 UTSW 14 28905265 makesense probably null
R6706:Cacna2d3 UTSW 14 29124685 critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 29055977 missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28969318 intron probably benign
R7069:Cacna2d3 UTSW 14 28969303 intron probably benign
R7146:Cacna2d3 UTSW 14 29721697 missense unknown
R7427:Cacna2d3 UTSW 14 29064275 missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 29064275 missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 29058618 missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 29045544 splice site probably null
R7560:Cacna2d3 UTSW 14 29058421 missense probably benign 0.18
R7703:Cacna2d3 UTSW 14 29043546 missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 29105038 splice site probably benign
R8096:Cacna2d3 UTSW 14 29103700 missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28982371 missense probably benign 0.25
Z1088:Cacna2d3 UTSW 14 29064308 missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29347163 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGGTAAACTGAGAGCACCATCC -3'
(R):5'- ACACGCTCTTTGTACCCACATG -3'

Sequencing Primer
(F):5'- GTTAACAACTTGTTCATGACAGCTCC -3'
(R):5'- GTACCCACATGTGTTTTAGTTTCTG -3'
Posted On2019-07-16