Incidental Mutation 'R7075:Sh3yl1'
ID568396
Institutional Source Beutler Lab
Gene Symbol Sh3yl1
Ensembl Gene ENSMUSG00000020669
Gene NameSh3 domain YSC-like 1
SynonymsYSC84, Ray
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7075 (G1)
Quality Score192.009
Status Validated
Chromosome12
Chromosomal Location30911668-30960162 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 30940166 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020997] [ENSMUST00000110880]
Predicted Effect probably null
Transcript: ENSMUST00000020997
SMART Domains Protein: ENSMUSP00000020997
Gene: ENSMUSG00000020669

DomainStartEndE-ValueType
Pfam:Ysc84 86 209 1.9e-42 PFAM
SH3 284 340 9.6e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110880
SMART Domains Protein: ENSMUSP00000106504
Gene: ENSMUSG00000020669

DomainStartEndE-ValueType
Pfam:DUF500 47 172 2.9e-44 PFAM
SH3 246 302 9.6e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (60/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp1 A T 12: 85,279,008 H72Q unknown Het
Afmid T A 11: 117,835,705 D218E probably benign Het
Ankhd1 T C 18: 36,559,989 V1A Het
Atf7ip T C 6: 136,596,515 probably null Het
BC024139 C T 15: 76,124,399 V326I probably benign Het
Bfsp1 T A 2: 143,848,965 Q159L probably damaging Het
Cct2 A T 10: 117,061,465 W125R unknown Het
Cnksr3 G T 10: 7,152,931 T147K probably benign Het
Colq C G 14: 31,552,909 G101R probably damaging Het
Dlg5 G T 14: 24,177,797 T352K possibly damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ebna1bp2 T C 4: 118,622,102 V119A probably benign Het
Eif2ak4 C T 2: 118,420,810 Q318* probably null Het
Eif2b1 G A 5: 124,571,251 T286M probably damaging Het
Fam53b G T 7: 132,759,623 D225E probably damaging Het
Fh1 A G 1: 175,607,855 I354T probably benign Het
Fnbp1 T C 2: 31,058,914 H206R probably benign Het
Gabrg3 A T 7: 57,323,696 D74E probably damaging Het
Galnt18 A T 7: 111,556,388 V246E possibly damaging Het
Glt6d1 T C 2: 25,795,280 R44G probably benign Het
Gm17087 T C 17: 8,566,803 M23V probably benign Het
Gpr160 A T 3: 30,896,777 I333L possibly damaging Het
Hars T C 18: 36,772,355 N142S possibly damaging Het
Hmgcll1 T C 9: 76,056,552 V97A possibly damaging Het
Itih4 T G 14: 30,892,603 V474G probably damaging Het
Keap1 C T 9: 21,231,256 V568I probably benign Het
Kifc5b A G 17: 26,925,898 M633V probably benign Het
Lsm4 A G 8: 70,677,785 E18G probably damaging Het
Meox1 T A 11: 101,893,743 Q88L probably damaging Het
Mettl25 T C 10: 105,829,924 N147S possibly damaging Het
Mphosph9 A C 5: 124,320,859 W83G probably damaging Het
Olfr1006 T A 2: 85,674,824 Y109F Het
Olfr1098 T G 2: 86,922,646 K295N possibly damaging Het
Olfr344 T C 2: 36,569,180 I194T probably benign Het
Olfr862 T A 9: 19,884,063 M81L probably benign Het
Olfr878 T C 9: 37,919,074 V139A probably benign Het
Olfr992 T C 2: 85,400,200 D111G probably damaging Het
Otogl G T 10: 107,778,929 T1954K probably benign Het
Padi2 T C 4: 140,933,217 V336A probably damaging Het
Phf21a C T 2: 92,360,379 Q675* probably null Het
Ppip5k1 T C 2: 121,321,750 E1092G probably damaging Het
Psg21 T C 7: 18,654,861 N102S probably damaging Het
Ralgapa1 C A 12: 55,820,723 Q15H possibly damaging Het
Rbm26 A T 14: 105,160,607 D26E unknown Het
Rbp4 T C 19: 38,124,061 Y152C probably damaging Het
Recql4 A G 15: 76,706,424 V646A possibly damaging Het
Rnf220 A T 4: 117,285,882 M63K probably benign Het
Selenok T C 14: 29,970,067 S21P probably damaging Het
Senp1 A G 15: 98,058,326 V404A probably benign Het
Snx32 A G 19: 5,496,990 L275P probably damaging Het
Ssfa2 T A 2: 79,635,660 S41T probably damaging Het
Stat5a T C 11: 100,879,693 V519A possibly damaging Het
Tbc1d10b A T 7: 127,203,238 V388E possibly damaging Het
Tdrd6 A G 17: 43,625,174 V1661A probably benign Het
Tmem63a T A 1: 180,961,149 F350L probably damaging Het
Trio A T 15: 27,898,000 I401K unknown Het
Ttn T C 2: 76,716,829 E32291G probably damaging Het
Tubgcp5 G T 7: 55,829,407 V1002L probably benign Het
Vav3 C T 3: 109,525,924 T410I possibly damaging Het
Vmn1r1 A T 1: 182,158,032 F23I probably benign Het
Vmn2r84 T A 10: 130,391,072 Q299L probably damaging Het
Vmn2r85 T A 10: 130,422,688 E499D probably benign Het
Other mutations in Sh3yl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Sh3yl1 APN 12 30939564 splice site probably benign
IGL02129:Sh3yl1 APN 12 30942877 splice site probably benign
IGL02448:Sh3yl1 APN 12 30939667 missense probably damaging 0.99
IGL03181:Sh3yl1 APN 12 30941980 missense possibly damaging 0.74
IGL03381:Sh3yl1 APN 12 30926837 missense possibly damaging 0.94
R1954:Sh3yl1 UTSW 12 30922333 missense possibly damaging 0.57
R1955:Sh3yl1 UTSW 12 30922333 missense possibly damaging 0.57
R1956:Sh3yl1 UTSW 12 30942788 critical splice acceptor site probably null
R1957:Sh3yl1 UTSW 12 30942788 critical splice acceptor site probably null
R2248:Sh3yl1 UTSW 12 30942870 critical splice donor site probably null
R3430:Sh3yl1 UTSW 12 30959842 missense probably benign 0.00
R4776:Sh3yl1 UTSW 12 30940314 missense probably damaging 1.00
R5505:Sh3yl1 UTSW 12 30942073 missense probably damaging 1.00
R6152:Sh3yl1 UTSW 12 30942035 missense probably benign 0.01
R7765:Sh3yl1 UTSW 12 30958869 missense probably damaging 1.00
R7904:Sh3yl1 UTSW 12 30941996 missense probably benign
R7987:Sh3yl1 UTSW 12 30941996 missense probably benign
R8036:Sh3yl1 UTSW 12 30942099 missense not run
Predicted Primers PCR Primer
(F):5'- AGAGATACAATTGCGCCTACTTAC -3'
(R):5'- CTTCCAGGGAGATACCAGCAAAG -3'

Sequencing Primer
(F):5'- GATACAATTGCGCCTACTTACAGAAG -3'
(R):5'- CCTGGACTTGCAGTATGTGAAGAC -3'
Posted On2019-07-16