Incidental Mutation 'R7091:Prmt5'
ID568417
Institutional Source Beutler Lab
Gene Symbol Prmt5
Ensembl Gene ENSMUSG00000023110
Gene Nameprotein arginine N-methyltransferase 5
SynonymsJak-binding protein 1, Jbp1, Skb1
MMRRC Submission
Accession Numbers

Genbank: NM_013768.3; Ensembl: ENSMUST00000023873

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7091 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location54507187-54517525 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 54511342 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023873] [ENSMUST00000132227] [ENSMUST00000147214]
Predicted Effect probably null
Transcript: ENSMUST00000023873
SMART Domains Protein: ENSMUSP00000023873
Gene: ENSMUSG00000023110

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
Pfam:PRMT5 181 619 4.5e-184 PFAM
Pfam:SAMBD 184 465 3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132227
SMART Domains Protein: ENSMUSP00000138549
Gene: ENSMUSG00000023110

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
PDB:4GQB|A 19 40 5e-7 PDB
Predicted Effect probably null
Transcript: ENSMUST00000139964
SMART Domains Protein: ENSMUSP00000121502
Gene: ENSMUSG00000023110

DomainStartEndE-ValueType
Pfam:PRMT5 1 62 1.3e-10 PFAM
Pfam:SAMBD 1 203 4.6e-68 PFAM
Pfam:PRMT5 52 203 1.2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147214
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes an enzyme that belongs to the methyltransferase family. The encoded protein catalyzes the transfer of methyl groups to the amino acid arginine, in target proteins that include histones, transcriptional elongation factors and the tumor suppressor p53. This gene plays a role in several cellular processes, including transcriptional regulation and the assembly of small nuclear ribonucleoproteins. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation with failure of inner cell mass proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(4) Gene trapped(5)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Prmt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Prmt5 APN 14 54509877 missense probably damaging 1.00
IGL01586:Prmt5 APN 14 54509951 unclassified probably benign
IGL02063:Prmt5 APN 14 54511020 nonsense probably null
IGL02249:Prmt5 APN 14 54509865 missense probably damaging 1.00
IGL03024:Prmt5 APN 14 54516598 missense possibly damaging 0.93
skipper UTSW 14 54509911 missense probably damaging 1.00
1mM(1):Prmt5 UTSW 14 54511500 critical splice donor site probably null
R0485:Prmt5 UTSW 14 54511255 missense probably damaging 1.00
R0664:Prmt5 UTSW 14 54507856 missense probably damaging 0.99
R1473:Prmt5 UTSW 14 54508915 missense probably damaging 1.00
R2106:Prmt5 UTSW 14 54507917 missense probably benign 0.00
R2159:Prmt5 UTSW 14 54515338 missense probably benign 0.03
R4728:Prmt5 UTSW 14 54507907 missense probably benign 0.00
R4843:Prmt5 UTSW 14 54516125 missense probably benign 0.33
R5261:Prmt5 UTSW 14 54507916 missense probably damaging 0.96
R5277:Prmt5 UTSW 14 54509942 missense probably benign 0.02
R5736:Prmt5 UTSW 14 54514840 missense probably null 0.84
R5892:Prmt5 UTSW 14 54509911 missense probably damaging 1.00
R5945:Prmt5 UTSW 14 54514887 missense possibly damaging 0.52
R7021:Prmt5 UTSW 14 54515388 missense probably damaging 1.00
R7172:Prmt5 UTSW 14 54514886 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACAGCATTGGGGTTCTTCTCC -3'
(R):5'- ATGAAGTGTTTGAAAAGGACCC -3'

Sequencing Primer
(F):5'- GGGGTTCTTCTCCACAGCATACAG -3'
(R):5'- TGTTTGAAAAGGACCCCATCAAATAC -3'
Posted On2019-07-17