Incidental Mutation 'R0638:Unkl'
ID 56842
Institutional Source Beutler Lab
Gene Symbol Unkl
Ensembl Gene ENSMUSG00000015127
Gene Name unkempt family like zinc finger
Synonyms 1300004G08Rik
MMRRC Submission 038827-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R0638 (G1)
Quality Score 165
Status Validated
Chromosome 17
Chromosomal Location 25407371-25453417 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 25427057 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039734] [ENSMUST00000160785] [ENSMUST00000160896]
AlphaFold Q5FWH2
Predicted Effect probably benign
Transcript: ENSMUST00000039734
SMART Domains Protein: ENSMUSP00000039670
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
low complexity region 61 69 N/A INTRINSIC
ZnF_C3H1 76 103 1.33e-1 SMART
Blast:ZnF_C3H1 115 144 7e-13 BLAST
ZnF_C3H1 207 232 2.49e1 SMART
ZnF_C3H1 243 276 9.28e-1 SMART
ZnF_C3H1 285 312 8.47e-4 SMART
low complexity region 371 412 N/A INTRINSIC
low complexity region 463 495 N/A INTRINSIC
low complexity region 499 505 N/A INTRINSIC
low complexity region 511 527 N/A INTRINSIC
coiled coil region 561 642 N/A INTRINSIC
RING 686 720 4.13e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160785
SMART Domains Protein: ENSMUSP00000124121
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
low complexity region 36 44 N/A INTRINSIC
Blast:ZnF_C3H1 51 78 3e-12 BLAST
Blast:ZnF_C3H1 90 119 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160896
SMART Domains Protein: ENSMUSP00000124276
Gene: ENSMUSG00000015127

DomainStartEndE-ValueType
ZnF_C3H1 21 46 2.49e1 SMART
ZnF_C3H1 57 90 9.28e-1 SMART
ZnF_C3H1 99 126 8.47e-4 SMART
low complexity region 185 226 N/A INTRINSIC
low complexity region 277 309 N/A INTRINSIC
low complexity region 313 319 N/A INTRINSIC
low complexity region 325 341 N/A INTRINSIC
coiled coil region 375 456 N/A INTRINSIC
RING 500 534 4.13e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162838
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RING finger protein that may function in Rac signaling. It can bind to Brg/Brm-associated factor 60b and can promote its ubiquitination. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,547,572 (GRCm39) Q161K probably benign Het
Aatk A T 11: 119,900,748 (GRCm39) L1216Q probably damaging Het
Aifm3 T C 16: 17,321,535 (GRCm39) F463L possibly damaging Het
Antxr2 C T 5: 98,108,496 (GRCm39) W338* probably null Het
Apc2 T C 10: 80,140,801 (GRCm39) S219P probably damaging Het
Arfgap3 A T 15: 83,192,389 (GRCm39) probably null Het
Arrdc5 A G 17: 56,607,020 (GRCm39) V75A possibly damaging Het
Atg16l2 A T 7: 100,949,317 (GRCm39) probably null Het
Cacna1i A G 15: 80,265,281 (GRCm39) N1511S possibly damaging Het
Cad T C 5: 31,235,032 (GRCm39) Y2095H probably damaging Het
Chia1 T C 3: 106,035,753 (GRCm39) probably benign Het
Crybg2 A G 4: 133,801,765 (GRCm39) D975G probably damaging Het
Dagla T C 19: 10,232,247 (GRCm39) I480V probably damaging Het
Efl1 C T 7: 82,301,095 (GRCm39) T33I probably damaging Het
Esp36 A G 17: 38,728,060 (GRCm39) F74L probably benign Het
Faim T C 9: 98,874,149 (GRCm39) probably benign Het
Fam83h G T 15: 75,875,776 (GRCm39) H520Q probably benign Het
Fbn2 A T 18: 58,178,446 (GRCm39) C1931S probably damaging Het
Frs3 A G 17: 48,012,581 (GRCm39) D96G probably benign Het
Gbp4 A G 5: 105,269,706 (GRCm39) M374T probably damaging Het
Gimap1 C T 6: 48,718,359 (GRCm39) probably benign Het
Gm10010 A G 6: 128,177,576 (GRCm39) noncoding transcript Het
Gm10355 T C 3: 101,214,214 (GRCm39) noncoding transcript Het
Gmip C T 8: 70,264,095 (GRCm39) probably benign Het
Gpc2 A T 5: 138,276,796 (GRCm39) F110Y possibly damaging Het
Ifi44l C T 3: 151,468,396 (GRCm39) V45M probably benign Het
Il15 T C 8: 83,069,890 (GRCm39) E58G probably damaging Het
Kat2b T C 17: 53,951,771 (GRCm39) probably benign Het
Kcnh7 C A 2: 62,607,854 (GRCm39) V576L probably benign Het
Lrrc66 T A 5: 73,772,816 (GRCm39) probably benign Het
Mical1 A G 10: 41,358,235 (GRCm39) E416G probably benign Het
Mroh3 A G 1: 136,118,740 (GRCm39) Y526H probably damaging Het
Mtx2 T C 2: 74,699,634 (GRCm39) probably benign Het
Naip6 A T 13: 100,437,036 (GRCm39) Y496N probably benign Het
Nfyc A G 4: 120,626,081 (GRCm39) S73P probably benign Het
Or10v9 C T 19: 11,832,487 (GRCm39) V277M probably damaging Het
Or10v9 A C 19: 11,832,732 (GRCm39) V195G probably damaging Het
Or1e23 T A 11: 73,407,750 (GRCm39) I92F probably damaging Het
Or5ak25 A G 2: 85,268,845 (GRCm39) I219T probably benign Het
Or6c69b T A 10: 129,627,101 (GRCm39) D119V probably damaging Het
P2ry14 A G 3: 59,022,869 (GRCm39) V206A probably benign Het
Polg G A 7: 79,109,896 (GRCm39) probably benign Het
Potefam1 T C 2: 111,030,763 (GRCm39) E382G probably damaging Het
Ptgs1 G A 2: 36,130,868 (GRCm39) probably benign Het
Pus7l A G 15: 94,421,298 (GRCm39) S671P probably benign Het
Ralgapa2 T C 2: 146,184,112 (GRCm39) T1547A probably benign Het
Rif1 T C 2: 52,001,600 (GRCm39) S1685P probably benign Het
Rnf213 T C 11: 119,361,036 (GRCm39) Y4452H probably damaging Het
Samd7 A G 3: 30,810,670 (GRCm39) D229G probably benign Het
Serpina3j T C 12: 104,281,078 (GRCm39) S84P possibly damaging Het
Slc35d1 A G 4: 103,070,441 (GRCm39) probably benign Het
Sorbs2 A G 8: 46,249,347 (GRCm39) D847G probably damaging Het
Sp110 A C 1: 85,505,050 (GRCm39) F434C probably benign Het
Steap4 T C 5: 8,027,030 (GRCm39) probably benign Het
Tg A C 15: 66,589,057 (GRCm39) T13P probably damaging Het
Timeless T A 10: 128,080,542 (GRCm39) Y474* probably null Het
Tmem94 T C 11: 115,682,886 (GRCm39) probably null Het
Trdmt1 G A 2: 13,521,459 (GRCm39) probably benign Het
Trim23 T C 13: 104,337,817 (GRCm39) Y522H probably benign Het
Ttc13 A T 8: 125,401,105 (GRCm39) S624T probably damaging Het
Txnl1 A G 18: 63,825,135 (GRCm39) probably benign Het
Usp54 T A 14: 20,639,437 (GRCm39) probably benign Het
Vcam1 T C 3: 115,910,908 (GRCm39) K497E possibly damaging Het
Vmn1r49 C A 6: 90,049,648 (GRCm39) S118I possibly damaging Het
Vmn2r118 T C 17: 55,915,466 (GRCm39) K495E probably benign Het
Wrnip1 G A 13: 33,005,073 (GRCm39) C560Y possibly damaging Het
Xkr5 T C 8: 18,983,563 (GRCm39) R660G probably benign Het
Zfp280c A G X: 47,637,580 (GRCm39) probably benign Het
Zfp707 G A 15: 75,846,978 (GRCm39) A291T possibly damaging Het
Other mutations in Unkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Unkl APN 17 25,429,822 (GRCm39) missense probably benign 0.00
IGL02011:Unkl APN 17 25,437,565 (GRCm39) missense probably damaging 1.00
IGL02141:Unkl APN 17 25,448,408 (GRCm39) missense probably damaging 1.00
R0226:Unkl UTSW 17 25,449,685 (GRCm39) missense probably damaging 0.96
R0394:Unkl UTSW 17 25,449,751 (GRCm39) critical splice donor site probably null
R1364:Unkl UTSW 17 25,408,597 (GRCm39) missense probably benign
R1596:Unkl UTSW 17 25,424,707 (GRCm39) missense probably null 1.00
R1899:Unkl UTSW 17 25,448,434 (GRCm39) splice site probably null
R1960:Unkl UTSW 17 25,428,619 (GRCm39) splice site probably benign
R3774:Unkl UTSW 17 25,407,381 (GRCm39) splice site probably null
R3927:Unkl UTSW 17 25,448,303 (GRCm39) missense probably damaging 0.99
R5164:Unkl UTSW 17 25,432,083 (GRCm39) splice site probably null
R5481:Unkl UTSW 17 25,420,146 (GRCm39) nonsense probably null
R5520:Unkl UTSW 17 25,424,584 (GRCm39) missense probably damaging 1.00
R5559:Unkl UTSW 17 25,424,687 (GRCm39) missense probably benign 0.00
R6267:Unkl UTSW 17 25,450,839 (GRCm39) makesense probably null
R6296:Unkl UTSW 17 25,450,839 (GRCm39) makesense probably null
R6883:Unkl UTSW 17 25,449,307 (GRCm39) missense probably damaging 1.00
R6979:Unkl UTSW 17 25,418,890 (GRCm39) missense probably damaging 1.00
R7752:Unkl UTSW 17 25,437,627 (GRCm39) missense probably damaging 1.00
R7901:Unkl UTSW 17 25,437,627 (GRCm39) missense probably damaging 1.00
R8712:Unkl UTSW 17 25,450,689 (GRCm39) missense possibly damaging 0.63
R9170:Unkl UTSW 17 25,448,350 (GRCm39) missense probably benign 0.00
R9331:Unkl UTSW 17 25,450,723 (GRCm39) missense probably damaging 1.00
R9393:Unkl UTSW 17 25,448,392 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACTGACGGTGAAGCTGCCAG -3'
(R):5'- TGAGTCCTACATGCCCTTCCAGTG -3'

Sequencing Primer
(F):5'- TGGTCACTTAACCTAAGTCTCAG -3'
(R):5'- GATCCCACACACAGCCAG -3'
Posted On 2013-07-11