Incidental Mutation 'R7037:Diexf'
ID568443
Institutional Source Beutler Lab
Gene Symbol Diexf
Ensembl Gene ENSMUSG00000016181
Gene Namedigestive organ expansion factor homolog (zebrafish)
SynonymsAA408296
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7037 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location193091104-193130272 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 193120723 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085555] [ENSMUST00000085555] [ENSMUST00000085555] [ENSMUST00000193460] [ENSMUST00000195291] [ENSMUST00000195848]
Predicted Effect probably null
Transcript: ENSMUST00000085555
SMART Domains Protein: ENSMUSP00000082691
Gene: ENSMUSG00000016181

DomainStartEndE-ValueType
low complexity region 51 70 N/A INTRINSIC
coiled coil region 72 113 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 217 224 N/A INTRINSIC
Pfam:UTP25 288 763 6.1e-200 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085555
SMART Domains Protein: ENSMUSP00000082691
Gene: ENSMUSG00000016181

DomainStartEndE-ValueType
low complexity region 51 70 N/A INTRINSIC
coiled coil region 72 113 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 217 224 N/A INTRINSIC
Pfam:UTP25 288 763 6.1e-200 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085555
SMART Domains Protein: ENSMUSP00000082691
Gene: ENSMUSG00000016181

DomainStartEndE-ValueType
low complexity region 51 70 N/A INTRINSIC
coiled coil region 72 113 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 217 224 N/A INTRINSIC
Pfam:UTP25 288 763 6.1e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193460
SMART Domains Protein: ENSMUSP00000142059
Gene: ENSMUSG00000016181

DomainStartEndE-ValueType
Pfam:DUF1253 1 205 6.8e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195291
SMART Domains Protein: ENSMUSP00000141676
Gene: ENSMUSG00000016181

DomainStartEndE-ValueType
low complexity region 51 70 N/A INTRINSIC
coiled coil region 72 113 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 217 224 N/A INTRINSIC
Pfam:DUF1253 325 634 6.9e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195848
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,768,043 N33I probably damaging Het
Ahnak2 A T 12: 112,774,278 V314D probably damaging Het
Arl14epl T G 18: 46,932,443 C92G probably benign Het
Atp6v1h T A 1: 5,149,992 M423K possibly damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b C T 2: 59,933,670 probably null Het
Bicral T C 17: 46,824,634 H550R probably benign Het
C1rl A G 6: 124,508,639 Y323C probably damaging Het
Ccr9 T A 9: 123,779,971 H239Q possibly damaging Het
Cdh16 T A 8: 104,617,635 R91* probably null Het
Coro1c A G 5: 113,845,396 F357S possibly damaging Het
Cpsf4 G A 5: 145,176,129 R141Q possibly damaging Het
Cryzl2 G A 1: 157,470,748 V236I probably damaging Het
Cttnbp2 T C 6: 18,435,118 E247G probably damaging Het
Dbr1 T A 9: 99,576,568 probably null Het
Dclk1 T C 3: 55,463,048 S23P probably damaging Het
Dpyd A T 3: 118,899,289 I361F probably benign Het
Elac2 A G 11: 64,983,711 E218G probably benign Het
Eml4 T A 17: 83,425,327 D136E probably benign Het
Fam198a G T 9: 121,965,526 V249L possibly damaging Het
Fam71e2 G T 7: 4,758,585 probably benign Het
Foxred1 A T 9: 35,207,548 S223T probably benign Het
Gm11595 A G 11: 99,772,648 C69R unknown Het
Gm14124 G T 2: 150,266,456 V46F possibly damaging Het
Gna14 A T 19: 16,533,764 H59L Het
H2-Ab1 T A 17: 34,267,989 I239N probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Itgb4 T A 11: 116,005,565 Y1379* probably null Het
Kank1 A G 19: 25,430,341 D1233G probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lrrc66 A T 5: 73,607,161 D846E probably benign Het
Lyst A G 13: 13,616,666 H38R probably damaging Het
Mc3r T C 2: 172,249,634 F259L probably damaging Het
Med25 A G 7: 44,882,782 Y384H probably damaging Het
Met A T 6: 17,547,128 probably benign Het
Mmp16 T C 4: 18,116,148 V584A possibly damaging Het
Mpp5 T A 12: 78,797,199 I59N probably damaging Het
Mrgprb3 A G 7: 48,643,194 L203P probably damaging Het
Mus81 A G 19: 5,486,080 L185P probably damaging Het
Naaa A G 5: 92,277,075 V75A possibly damaging Het
Obscn T A 11: 59,043,929 T5292S probably damaging Het
Obscn T C 11: 59,052,604 S4801G probably damaging Het
Olfr703 T C 7: 106,845,336 S242P probably damaging Het
Otof T C 5: 30,381,538 D1112G probably benign Het
Pbx4 A G 8: 69,864,875 R170G probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plce1 A T 19: 38,702,017 D715V probably damaging Het
Pms1 T C 1: 53,207,611 T311A possibly damaging Het
Popdc2 A G 16: 38,374,267 D350G probably damaging Het
Prex1 A G 2: 166,587,180 V661A probably benign Het
Ptbp2 A G 3: 119,751,908 Y130H probably damaging Het
Rev3l C T 10: 39,851,975 R2707W probably damaging Het
Rpl37 G A 15: 5,117,703 R75K probably null Het
Ryr3 T A 2: 112,949,130 R259* probably null Het
Scai A T 2: 39,190,621 S8T probably benign Het
Scn4a C A 11: 106,320,900 L1430F probably damaging Het
Sema5a A G 15: 32,686,847 K1035R probably damaging Het
Siah3 A G 14: 75,525,585 H92R probably benign Het
Smc4 G A 3: 69,018,195 V342I possibly damaging Het
Spata31d1a C T 13: 59,700,324 C1330Y possibly damaging Het
St18 C A 1: 6,803,036 H332N possibly damaging Het
Sycp1 T A 3: 102,898,934 E480D possibly damaging Het
Tex14 A T 11: 87,497,915 I323F probably damaging Het
Tm7sf2 A T 19: 6,064,077 probably null Het
Tmem241 G T 18: 12,113,406 H62Q probably benign Het
Tmem54 T A 4: 129,110,801 probably null Het
Tomm34 A G 2: 164,070,478 L39P probably damaging Het
Triml2 T A 8: 43,193,536 V354D probably damaging Het
Usp19 T C 9: 108,496,958 I738T possibly damaging Het
Utrn T A 10: 12,826,770 probably null Het
Other mutations in Diexf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Diexf APN 1 193115001 missense probably damaging 1.00
IGL01700:Diexf APN 1 193118265 missense probably damaging 1.00
IGL02076:Diexf APN 1 193130059 missense probably damaging 1.00
IGL02121:Diexf APN 1 193118278 missense probably benign 0.05
IGL02666:Diexf APN 1 193107596 nonsense probably null
IGL02997:Diexf APN 1 193120584 missense probably benign 0.34
3-1:Diexf UTSW 1 193118280 missense probably benign 0.07
R0099:Diexf UTSW 1 193128470 missense probably damaging 1.00
R0395:Diexf UTSW 1 193123676 missense possibly damaging 0.69
R0502:Diexf UTSW 1 193114828 splice site probably benign
R0973:Diexf UTSW 1 193114703 missense probably damaging 0.98
R0973:Diexf UTSW 1 193114703 missense probably damaging 0.98
R0974:Diexf UTSW 1 193114703 missense probably damaging 0.98
R1815:Diexf UTSW 1 193118283 missense probably benign 0.26
R1930:Diexf UTSW 1 193118309 missense probably damaging 1.00
R1931:Diexf UTSW 1 193118309 missense probably damaging 1.00
R1937:Diexf UTSW 1 193122093 missense probably damaging 1.00
R2847:Diexf UTSW 1 193128451 missense probably benign 0.41
R2848:Diexf UTSW 1 193128451 missense probably benign 0.41
R3412:Diexf UTSW 1 193128502 missense possibly damaging 0.93
R3414:Diexf UTSW 1 193128502 missense possibly damaging 0.93
R4471:Diexf UTSW 1 193130137 missense possibly damaging 0.68
R4627:Diexf UTSW 1 193107695 missense probably benign 0.00
R4644:Diexf UTSW 1 193128480 missense probably damaging 1.00
R4761:Diexf UTSW 1 193113922 missense probably damaging 1.00
R4791:Diexf UTSW 1 193128267 missense probably benign
R4793:Diexf UTSW 1 193113808 missense probably null 0.56
R4858:Diexf UTSW 1 193113764 missense probably damaging 1.00
R4944:Diexf UTSW 1 193114954 missense probably damaging 1.00
R5162:Diexf UTSW 1 193113781 missense probably damaging 1.00
R5347:Diexf UTSW 1 193128379 missense probably benign
R5837:Diexf UTSW 1 193118393 missense probably damaging 1.00
R6113:Diexf UTSW 1 193129502 missense probably null 0.01
R6455:Diexf UTSW 1 193128376 missense probably benign 0.07
R6563:Diexf UTSW 1 193118390 missense probably damaging 1.00
R6636:Diexf UTSW 1 193113767 missense probably damaging 1.00
R7018:Diexf UTSW 1 193114855 missense probably benign 0.06
X0050:Diexf UTSW 1 193123732 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CTCTTTCTGGAGCGGGGTAAAG -3'
(R):5'- TGAGACGTGTTCCTTGGAAC -3'

Sequencing Primer
(F):5'- AAGGAGCTATTTGATTTTTGAGGTCC -3'
(R):5'- AGACGTGTTCCTTGGAACAGTGAG -3'
Posted On2019-07-31