Incidental Mutation 'R7013:Adhfe1'
ID568470
Institutional Source Beutler Lab
Gene Symbol Adhfe1
Ensembl Gene ENSMUSG00000025911
Gene Namealcohol dehydrogenase, iron containing, 1
Synonyms6330565B14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R7013 (G1)
Quality Score223.009
Status Validated
Chromosome1
Chromosomal Location9547948-9580673 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 9550591 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000027044] [ENSMUST00000072079] [ENSMUST00000130927] [ENSMUST00000144177] [ENSMUST00000186467]
Predicted Effect probably benign
Transcript: ENSMUST00000027044
Predicted Effect probably benign
Transcript: ENSMUST00000072079
SMART Domains Protein: ENSMUSP00000071955
Gene: ENSMUSG00000061024

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:RRS1 31 193 3.5e-62 PFAM
low complexity region 302 337 N/A INTRINSIC
low complexity region 351 365 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000130927
AA Change: V43A
Predicted Effect probably benign
Transcript: ENSMUST00000144177
SMART Domains Protein: ENSMUSP00000116627
Gene: ENSMUSG00000025911

DomainStartEndE-ValueType
Pfam:Fe-ADH 50 454 2.1e-105 PFAM
Pfam:Fe-ADH_2 53 155 6.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186467
Predicted Effect probably benign
Transcript: ENSMUST00000190654
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ADHFE1 gene encodes hydroxyacid-oxoacid transhydrogenase (EC 1.1.99.24), which is responsible for the oxidation of 4-hydroxybutyrate in mammalian tissues (Kardon et al., 2006 [PubMed 16616524]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,641,386 I213V probably null Het
Abcc4 A T 14: 118,526,343 C952S probably benign Het
Apob T A 12: 8,010,080 L2854* probably null Het
Arhgap5 T A 12: 52,518,326 N693K probably benign Het
Arid5b A G 10: 68,097,819 V508A probably damaging Het
Atl1 A G 12: 69,953,440 E288G probably damaging Het
Bank1 A G 3: 136,100,509 S455P possibly damaging Het
Ces1c A T 8: 93,130,764 L63Q probably damaging Het
Crmp1 A T 5: 37,268,692 probably null Het
Csnka2ip T C 16: 64,478,417 D528G unknown Het
Dact2 T C 17: 14,203,534 T66A probably benign Het
Dkk2 T C 3: 132,174,999 L135P probably damaging Het
Drc3 A G 11: 60,387,303 N381S probably benign Het
Dsg4 T C 18: 20,458,521 V439A possibly damaging Het
Dysf C T 6: 84,137,358 P1240S probably damaging Het
Esyt1 A T 10: 128,525,651 V58E probably damaging Het
Exo1 G T 1: 175,893,772 A326S probably damaging Het
Fam20b A G 1: 156,690,565 S220P probably damaging Het
Fmo6 G A 1: 162,918,248 T402I probably benign Het
Galnt10 A T 11: 57,765,584 D198V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gsap A T 5: 21,278,110 E604D probably benign Het
Il20rb A G 9: 100,461,428 Y258H probably benign Het
Impg1 A T 9: 80,378,494 S409R probably damaging Het
Jak3 G T 8: 71,678,781 V97F possibly damaging Het
Lbhd1 T C 19: 8,884,159 S52P probably damaging Het
Lman2l A G 1: 36,443,518 probably benign Het
Lnpep C A 17: 17,568,363 M493I probably benign Het
Mpp4 T C 1: 59,149,615 D132G probably damaging Het
Nlrp1a G A 11: 71,123,552 R291W probably benign Het
Olfr1252 T A 2: 89,721,386 I242F probably benign Het
Olfr1309 G A 2: 111,983,963 A37V probably benign Het
Olfr142 C T 2: 90,252,097 R297Q possibly damaging Het
Olfr382 G T 11: 73,516,421 Y259* probably null Het
Olfr733 T A 14: 50,299,199 I37F probably damaging Het
Orc5 A G 5: 22,533,789 V158A probably benign Het
Pcdhga3 A G 18: 37,675,621 N376D probably damaging Het
Ptprr T A 10: 116,236,754 I207N probably damaging Het
Recql5 A G 11: 115,894,576 V698A probably benign Het
Rnf212 A T 5: 108,729,960 M222K probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Smap2 T C 4: 120,982,168 K121E probably damaging Het
Syt11 A T 3: 88,747,989 V335D possibly damaging Het
Terb1 A T 8: 104,488,590 C251* probably null Het
Tmprss11d C A 5: 86,326,573 R37L probably damaging Het
Ttbk2 T C 2: 120,745,784 N904S possibly damaging Het
Vmn1r119 T A 7: 21,011,789 I223F probably damaging Het
Vmn1r66 T C 7: 10,274,756 R117G possibly damaging Het
Zfp106 T C 2: 120,531,632 D1025G probably damaging Het
Other mutations in Adhfe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Adhfe1 APN 1 9566863 missense probably benign
IGL01735:Adhfe1 APN 1 9548148 missense possibly damaging 0.90
IGL02862:Adhfe1 APN 1 9553811 missense probably damaging 1.00
IGL02891:Adhfe1 APN 1 9558171 missense probably benign
IGL03198:Adhfe1 APN 1 9549952 splice site probably benign
IGL03297:Adhfe1 APN 1 9549948 splice site probably benign
R0095:Adhfe1 UTSW 1 9560177 missense possibly damaging 0.79
R0180:Adhfe1 UTSW 1 9563857 missense probably benign 0.00
R0347:Adhfe1 UTSW 1 9553430 missense probably benign 0.00
R0590:Adhfe1 UTSW 1 9548153 critical splice donor site probably null
R1509:Adhfe1 UTSW 1 9553446 missense probably benign 0.03
R1606:Adhfe1 UTSW 1 9553473 critical splice donor site probably null
R1720:Adhfe1 UTSW 1 9566900 missense probably benign 0.01
R2048:Adhfe1 UTSW 1 9563553 missense probably benign 0.00
R3918:Adhfe1 UTSW 1 9576216 missense probably damaging 0.99
R4375:Adhfe1 UTSW 1 9561628 intron probably benign
R4576:Adhfe1 UTSW 1 9553754 missense probably damaging 1.00
R4653:Adhfe1 UTSW 1 9550578 intron probably benign
R4724:Adhfe1 UTSW 1 9576250 missense probably damaging 0.99
R4760:Adhfe1 UTSW 1 9563523 missense probably damaging 0.97
R4859:Adhfe1 UTSW 1 9558213 missense probably damaging 1.00
R4967:Adhfe1 UTSW 1 9566804 missense probably benign 0.11
R4970:Adhfe1 UTSW 1 9558238 missense possibly damaging 0.92
R5087:Adhfe1 UTSW 1 9561626 intron probably benign
R6146:Adhfe1 UTSW 1 9553718 missense probably damaging 0.98
R7084:Adhfe1 UTSW 1 9566805 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAATGTTTAGGTTCTTGAGGAGC -3'
(R):5'- GCTGAAAACAAAATTGTGCCTG -3'

Sequencing Primer
(F):5'- AGGAGCAAGTCTTTTGGGG -3'
(R):5'- TTTTTCCAGGGGCGAGATCCC -3'
Posted On2019-07-31