Incidental Mutation 'R7013:Lman2l'
ID568471
Institutional Source Beutler Lab
Gene Symbol Lman2l
Ensembl Gene ENSMUSG00000001143
Gene Namelectin, mannose-binding 2-like
SynonymsA630028F14Rik, VIP36-like
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R7013 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location36419871-36445271 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 36443518 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000001171] [ENSMUST00000115011] [ENSMUST00000123583] [ENSMUST00000125304]
Predicted Effect silent
Transcript: ENSMUST00000001171
SMART Domains Protein: ENSMUSP00000137028
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 146 1.5e-34 PFAM
Predicted Effect silent
Transcript: ENSMUST00000115011
SMART Domains Protein: ENSMUSP00000110663
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 286 2e-84 PFAM
transmembrane domain 324 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123583
SMART Domains Protein: ENSMUSP00000137344
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000125304
SMART Domains Protein: ENSMUSP00000117200
Gene: ENSMUSG00000001143

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Lectin_leg-like 48 275 3.2e-88 PFAM
transmembrane domain 313 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192969
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the L-type lectin group of type 1 membrane proteins, which function in the mammalian early secretory pathway. These proteins contain luminal carbohydrate recognition domains, which display homology to leguminous lectins. Unlike other proteins of the group, which cycle in the early secretory pathway and are predominantly associated with post endoplasmic reticulum membranes, the protein encoded by this gene is a non-cycling resident protein of the ER, where it functions as a cargo receptor for glycoproteins. It is proposed to regulate exchange of folded proteins for transport to the Golgi and exchange of misfolded glycoproteins for transport to the ubiquitin-proteasome pathway. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,641,386 I213V probably null Het
Abcc4 A T 14: 118,526,343 C952S probably benign Het
Adhfe1 T C 1: 9,550,591 probably benign Het
Apob T A 12: 8,010,080 L2854* probably null Het
Arhgap5 T A 12: 52,518,326 N693K probably benign Het
Arid5b A G 10: 68,097,819 V508A probably damaging Het
Atl1 A G 12: 69,953,440 E288G probably damaging Het
Bank1 A G 3: 136,100,509 S455P possibly damaging Het
Ces1c A T 8: 93,130,764 L63Q probably damaging Het
Crmp1 A T 5: 37,268,692 probably null Het
Csnka2ip T C 16: 64,478,417 D528G unknown Het
Dact2 T C 17: 14,203,534 T66A probably benign Het
Dkk2 T C 3: 132,174,999 L135P probably damaging Het
Drc3 A G 11: 60,387,303 N381S probably benign Het
Dsg4 T C 18: 20,458,521 V439A possibly damaging Het
Dysf C T 6: 84,137,358 P1240S probably damaging Het
Esyt1 A T 10: 128,525,651 V58E probably damaging Het
Exo1 G T 1: 175,893,772 A326S probably damaging Het
Fam20b A G 1: 156,690,565 S220P probably damaging Het
Fmo6 G A 1: 162,918,248 T402I probably benign Het
Galnt10 A T 11: 57,765,584 D198V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gsap A T 5: 21,278,110 E604D probably benign Het
Il20rb A G 9: 100,461,428 Y258H probably benign Het
Impg1 A T 9: 80,378,494 S409R probably damaging Het
Jak3 G T 8: 71,678,781 V97F possibly damaging Het
Lbhd1 T C 19: 8,884,159 S52P probably damaging Het
Lnpep C A 17: 17,568,363 M493I probably benign Het
Mpp4 T C 1: 59,149,615 D132G probably damaging Het
Nlrp1a G A 11: 71,123,552 R291W probably benign Het
Olfr1252 T A 2: 89,721,386 I242F probably benign Het
Olfr1309 G A 2: 111,983,963 A37V probably benign Het
Olfr142 C T 2: 90,252,097 R297Q possibly damaging Het
Olfr382 G T 11: 73,516,421 Y259* probably null Het
Olfr733 T A 14: 50,299,199 I37F probably damaging Het
Orc5 A G 5: 22,533,789 V158A probably benign Het
Pcdhga3 A G 18: 37,675,621 N376D probably damaging Het
Ptprr T A 10: 116,236,754 I207N probably damaging Het
Recql5 A G 11: 115,894,576 V698A probably benign Het
Rnf212 A T 5: 108,729,960 M222K probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Smap2 T C 4: 120,982,168 K121E probably damaging Het
Syt11 A T 3: 88,747,989 V335D possibly damaging Het
Terb1 A T 8: 104,488,590 C251* probably null Het
Tmprss11d C A 5: 86,326,573 R37L probably damaging Het
Ttbk2 T C 2: 120,745,784 N904S possibly damaging Het
Vmn1r119 T A 7: 21,011,789 I223F probably damaging Het
Vmn1r66 T C 7: 10,274,756 R117G possibly damaging Het
Zfp106 T C 2: 120,531,632 D1025G probably damaging Het
Other mutations in Lman2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lman2l APN 1 36438834 critical splice acceptor site probably null
IGL02301:Lman2l APN 1 36443543 missense probably damaging 1.00
IGL03288:Lman2l APN 1 36443547 missense probably damaging 0.98
IGL03295:Lman2l APN 1 36438811 missense probably damaging 1.00
R0128:Lman2l UTSW 1 36424864 nonsense probably null
R0130:Lman2l UTSW 1 36424864 nonsense probably null
R0981:Lman2l UTSW 1 36445233 start codon destroyed unknown
R2010:Lman2l UTSW 1 36445181 nonsense probably null
R2039:Lman2l UTSW 1 36428454 missense probably damaging 1.00
R2343:Lman2l UTSW 1 36428109 missense possibly damaging 0.90
R4195:Lman2l UTSW 1 36424941 missense probably damaging 0.98
R4394:Lman2l UTSW 1 36439723 missense probably damaging 1.00
R4526:Lman2l UTSW 1 36438763 missense probably damaging 0.98
R5747:Lman2l UTSW 1 36424957 missense possibly damaging 0.90
R6156:Lman2l UTSW 1 36438826 missense probably damaging 1.00
R6264:Lman2l UTSW 1 36438769 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACTCCTGTATTATGAAGTTCACC -3'
(R):5'- AAATAATGGCTCCAGTCTTTGTAGG -3'

Sequencing Primer
(F):5'- ACTGGGAATTGAACTCAGGTCCTC -3'
(R):5'- AGGATCTGGCTTTGTGAACC -3'
Posted On2019-07-31