Incidental Mutation 'R7002:Abl2'
ID568480
Institutional Source Beutler Lab
Gene Symbol Abl2
Ensembl Gene ENSMUSG00000026596
Gene Namev-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene)
SynonymsAbll, Arg
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R7002 (G1)
Quality Score60.0073
Status Validated
Chromosome1
Chromosomal Location156558786-156649568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156559133 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 29 (R29W)
Ref Sequence ENSEMBL: ENSMUSP00000133381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027888] [ENSMUST00000166172] [ENSMUST00000173929]
Predicted Effect probably damaging
Transcript: ENSMUST00000027888
AA Change: R29W

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027888
Gene: ENSMUSG00000026596
AA Change: R29W

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 110 166 9.83e-16 SMART
SH2 171 254 1.34e-33 SMART
TyrKc 288 539 2.53e-148 SMART
low complexity region 561 577 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 734 752 N/A INTRINSIC
low complexity region 877 891 N/A INTRINSIC
low complexity region 974 991 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
FABD 1061 1182 5.24e-65 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166172
AA Change: R29W

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126181
Gene: ENSMUSG00000026596
AA Change: R29W

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 110 166 9.83e-16 SMART
SH2 171 254 1.34e-33 SMART
TyrKc 288 539 2.53e-148 SMART
low complexity region 561 577 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 773 787 N/A INTRINSIC
low complexity region 870 887 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
FABD 957 1078 5.24e-65 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173929
AA Change: R29W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133381
Gene: ENSMUSG00000026596
AA Change: R29W

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 89 139 4.35e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Abelson family of nonreceptor tyrosine protein kinases. The protein is highly similar to the c-abl oncogene 1 protein, including the tyrosine kinase, SH2 and SH3 domains, and it plays a role in cytoskeletal rearrangements through its C-terminal F-actin- and microtubule-binding sequences. This gene is expressed in both normal and tumor cells, and is involved in translocation with the ets variant 6 gene in leukemia. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display multiple behavioral abnormalities indicating neuronal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,941,564 S1308P probably damaging Het
Adam6b C A 12: 113,489,707 S48* probably null Het
Adamts18 T A 8: 113,775,290 D313V possibly damaging Het
Aoc1 A G 6: 48,905,876 S229G probably benign Het
Apol10a G A 15: 77,484,846 R15H possibly damaging Het
Bend4 T A 5: 67,398,259 T535S probably benign Het
Blm T C 7: 80,469,753 K1024R probably benign Het
Brca2 T C 5: 150,539,918 V1049A probably benign Het
Cerk T C 15: 86,156,594 Y188C possibly damaging Het
Cic C T 7: 25,272,196 R451C probably damaging Het
Col18a1 A T 10: 77,166,343 V10E unknown Het
Cplx1 T A 5: 108,520,316 K58M probably damaging Het
Crybg1 T A 10: 43,998,835 D759V probably damaging Het
Cwc25 A T 11: 97,748,071 N342K probably damaging Het
Dab2 A T 15: 6,435,365 T566S probably benign Het
Depdc5 G A 5: 32,877,158 probably null Het
Dip2b T A 15: 100,160,465 N408K probably benign Het
Dnah12 T C 14: 26,876,998 I3631T probably damaging Het
Dnase1 A G 16: 4,039,546 I236V possibly damaging Het
Duox1 C T 2: 122,319,877 Q196* probably null Het
Eef2k G A 7: 120,891,932 R547Q probably benign Het
Erich5 C T 15: 34,471,362 L246F probably damaging Het
Frmpd1 C T 4: 45,284,200 A1007V probably benign Het
Fsip2 T A 2: 82,989,343 I5140N possibly damaging Het
Gan T C 8: 117,195,847 C440R possibly damaging Het
Garnl3 T A 2: 33,054,193 H73L possibly damaging Het
Gid8 T G 2: 180,713,303 M34R possibly damaging Het
Gjd4 C A 18: 9,280,960 L39F possibly damaging Het
Gm5868 T A 5: 72,586,420 probably null Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grhpr T C 4: 44,990,427 S306P probably damaging Het
Hdac4 T G 1: 91,968,361 K729T possibly damaging Het
Hist2h2be A G 3: 96,221,373 I70V probably benign Het
Igfbp2 C T 1: 72,849,645 H85Y probably damaging Het
Igkv4-61 T G 6: 69,417,389 I13L probably benign Het
Il18r1 G A 1: 40,474,853 S73N probably benign Het
Immt T C 6: 71,861,040 V244A probably damaging Het
Irs1 T C 1: 82,288,260 Y745C probably benign Het
Itpr3 T C 17: 27,110,580 V1526A probably benign Het
Jrkl A T 9: 13,245,521 I45K probably damaging Het
Lamp3 G T 16: 19,655,422 Q401K possibly damaging Het
Lrrfip1 T A 1: 91,115,458 H528Q probably benign Het
Ltn1 A T 16: 87,423,473 D245E probably benign Het
Mnat1 T C 12: 73,230,705 probably benign Het
Mpp6 C T 6: 50,162,662 P116L probably benign Het
Mprip A C 11: 59,761,190 M1907L probably benign Het
Mut T A 17: 40,941,383 I272N possibly damaging Het
Nfu1 C A 6: 87,016,272 H131Q probably benign Het
Nup188 T A 2: 30,323,568 S670R probably damaging Het
Olfr1090 T C 2: 86,754,681 D19G probably benign Het
Olfr1477 A G 19: 13,502,675 N111D probably benign Het
Parp4 T A 14: 56,602,404 V523E probably damaging Het
Pbrm1 T A 14: 31,064,820 D631E probably benign Het
Prss40 A T 1: 34,552,400 probably null Het
Rnf13 A G 3: 57,833,612 N274S probably damaging Het
Rtl1 T A 12: 109,593,947 Y486F probably damaging Het
Sec14l3 A T 11: 4,075,263 H291L possibly damaging Het
Senp5 A G 16: 31,983,775 S532P probably damaging Het
Sepsecs T C 5: 52,647,208 probably null Het
Serpina1e T C 12: 103,948,079 I329V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,034 unknown Het
Smc5 A G 19: 23,231,883 V639A probably benign Het
Speg T A 1: 75,423,268 V2453E probably damaging Het
Syt2 T A 1: 134,744,104 F207I probably damaging Het
Tchp C T 5: 114,708,796 S48L probably benign Het
Trim12a A G 7: 104,304,176 S243P possibly damaging Het
Ttn T C 2: 76,798,217 E14533G probably damaging Het
Vmn1r50 T A 6: 90,107,837 M188K probably benign Het
Vps11 G A 9: 44,355,079 T437I probably damaging Het
Xrn1 C T 9: 96,047,790 T1498I probably benign Het
Zfp236 A G 18: 82,691,576 probably null Het
Zfp316 T C 5: 143,263,355 D175G unknown Het
Zmynd11 A G 13: 9,694,330 L256P probably damaging Het
Other mutations in Abl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Abl2 APN 1 156635184 missense probably damaging 1.00
IGL01679:Abl2 APN 1 156642465 missense probably benign 0.01
IGL02289:Abl2 APN 1 156629854 missense probably damaging 1.00
PIT4495001:Abl2 UTSW 1 156633185 missense probably damaging 1.00
R0907:Abl2 UTSW 1 156629859 missense probably damaging 1.00
R1232:Abl2 UTSW 1 156641730 missense probably damaging 1.00
R2069:Abl2 UTSW 1 156620827 splice site probably null
R4224:Abl2 UTSW 1 156633847 missense probably damaging 0.98
R4305:Abl2 UTSW 1 156641563 missense probably damaging 0.99
R4411:Abl2 UTSW 1 156630082 missense possibly damaging 0.86
R4490:Abl2 UTSW 1 156633779 missense probably damaging 1.00
R5132:Abl2 UTSW 1 156641832 nonsense probably null
R5383:Abl2 UTSW 1 156642232 missense possibly damaging 0.89
R5428:Abl2 UTSW 1 156642111 missense probably damaging 1.00
R5436:Abl2 UTSW 1 156629880 missense probably damaging 1.00
R5760:Abl2 UTSW 1 156641857 missense probably benign 0.06
R6051:Abl2 UTSW 1 156642085 missense probably damaging 1.00
R6955:Abl2 UTSW 1 156622649 missense probably damaging 1.00
R7038:Abl2 UTSW 1 156641409 missense possibly damaging 0.95
R7172:Abl2 UTSW 1 156622587 missense probably damaging 1.00
R7268:Abl2 UTSW 1 156633939 critical splice donor site probably null
R7282:Abl2 UTSW 1 156630060 missense probably damaging 1.00
R7303:Abl2 UTSW 1 156641250 missense probably benign 0.00
R7372:Abl2 UTSW 1 156622619 missense probably damaging 1.00
R7375:Abl2 UTSW 1 156622614 missense probably damaging 1.00
R7443:Abl2 UTSW 1 156625381 missense probably damaging 1.00
R7468:Abl2 UTSW 1 156622534 missense possibly damaging 0.68
R7614:Abl2 UTSW 1 156636859 missense possibly damaging 0.71
R7644:Abl2 UTSW 1 156615993 missense probably benign 0.08
R7783:Abl2 UTSW 1 156559071 missense probably benign
X0067:Abl2 UTSW 1 156631433 splice site probably null
Z1177:Abl2 UTSW 1 156641106 missense probably damaging 1.00
Z1177:Abl2 UTSW 1 156641553 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGGAGAGTCTGTGAGTCGCTG -3'
(R):5'- ATAGCAGGACAGTCAAGCCTG -3'

Sequencing Primer
(F):5'- TGAGTCGCTGGGAGGCAG -3'
(R):5'- TCAAGCCTGGGTCCCTAAGAC -3'
Posted On2019-08-05