Incidental Mutation 'R7002:Depdc5'
ID568481
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene NameDEP domain containing 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7002 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location32863701-32994236 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 32877158 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000118698] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000125574] [ENSMUST00000149350] [ENSMUST00000195980]
Predicted Effect probably null
Transcript: ENSMUST00000049780
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000087897
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118698
SMART Domains Protein: ENSMUSP00000112906
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 205 1.9e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119705
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120902
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000125574
SMART Domains Protein: ENSMUSP00000122173
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 137 6.9e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149350
SMART Domains Protein: ENSMUSP00000122461
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 161 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195980
SMART Domains Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 147 4e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,941,564 S1308P probably damaging Het
Abl2 A T 1: 156,559,133 R29W probably damaging Het
Adam6b C A 12: 113,489,707 S48* probably null Het
Adamts18 T A 8: 113,775,290 D313V possibly damaging Het
Aoc1 A G 6: 48,905,876 S229G probably benign Het
Apol10a G A 15: 77,484,846 R15H possibly damaging Het
Bend4 T A 5: 67,398,259 T535S probably benign Het
Blm T C 7: 80,469,753 K1024R probably benign Het
Brca2 T C 5: 150,539,918 V1049A probably benign Het
Cerk T C 15: 86,156,594 Y188C possibly damaging Het
Cic C T 7: 25,272,196 R451C probably damaging Het
Col18a1 A T 10: 77,166,343 V10E unknown Het
Cplx1 T A 5: 108,520,316 K58M probably damaging Het
Crybg1 T A 10: 43,998,835 D759V probably damaging Het
Cwc25 A T 11: 97,748,071 N342K probably damaging Het
Dab2 A T 15: 6,435,365 T566S probably benign Het
Dip2b T A 15: 100,160,465 N408K probably benign Het
Dnah12 T C 14: 26,876,998 I3631T probably damaging Het
Dnase1 A G 16: 4,039,546 I236V possibly damaging Het
Duox1 C T 2: 122,319,877 Q196* probably null Het
Eef2k G A 7: 120,891,932 R547Q probably benign Het
Erich5 C T 15: 34,471,362 L246F probably damaging Het
Frmpd1 C T 4: 45,284,200 A1007V probably benign Het
Fsip2 T A 2: 82,989,343 I5140N possibly damaging Het
Gan T C 8: 117,195,847 C440R possibly damaging Het
Garnl3 T A 2: 33,054,193 H73L possibly damaging Het
Gid8 T G 2: 180,713,303 M34R possibly damaging Het
Gjd4 C A 18: 9,280,960 L39F possibly damaging Het
Gm5868 T A 5: 72,586,420 probably null Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grhpr T C 4: 44,990,427 S306P probably damaging Het
Hdac4 T G 1: 91,968,361 K729T possibly damaging Het
Hist2h2be A G 3: 96,221,373 I70V probably benign Het
Igfbp2 C T 1: 72,849,645 H85Y probably damaging Het
Igkv4-61 T G 6: 69,417,389 I13L probably benign Het
Il18r1 G A 1: 40,474,853 S73N probably benign Het
Immt T C 6: 71,861,040 V244A probably damaging Het
Irs1 T C 1: 82,288,260 Y745C probably benign Het
Itpr3 T C 17: 27,110,580 V1526A probably benign Het
Jrkl A T 9: 13,245,521 I45K probably damaging Het
Lamp3 G T 16: 19,655,422 Q401K possibly damaging Het
Lrrfip1 T A 1: 91,115,458 H528Q probably benign Het
Ltn1 A T 16: 87,423,473 D245E probably benign Het
Mnat1 T C 12: 73,230,705 probably benign Het
Mpp6 C T 6: 50,162,662 P116L probably benign Het
Mprip A C 11: 59,761,190 M1907L probably benign Het
Mut T A 17: 40,941,383 I272N possibly damaging Het
Nfu1 C A 6: 87,016,272 H131Q probably benign Het
Nup188 T A 2: 30,323,568 S670R probably damaging Het
Olfr1090 T C 2: 86,754,681 D19G probably benign Het
Olfr1477 A G 19: 13,502,675 N111D probably benign Het
Parp4 T A 14: 56,602,404 V523E probably damaging Het
Pbrm1 T A 14: 31,064,820 D631E probably benign Het
Prss40 A T 1: 34,552,400 probably null Het
Rnf13 A G 3: 57,833,612 N274S probably damaging Het
Rtl1 T A 12: 109,593,947 Y486F probably damaging Het
Sec14l3 A T 11: 4,075,263 H291L possibly damaging Het
Senp5 A G 16: 31,983,775 S532P probably damaging Het
Sepsecs T C 5: 52,647,208 probably null Het
Serpina1e T C 12: 103,948,079 I329V probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,034 unknown Het
Smc5 A G 19: 23,231,883 V639A probably benign Het
Speg T A 1: 75,423,268 V2453E probably damaging Het
Syt2 T A 1: 134,744,104 F207I probably damaging Het
Tchp C T 5: 114,708,796 S48L probably benign Het
Trim12a A G 7: 104,304,176 S243P possibly damaging Het
Ttn T C 2: 76,798,217 E14533G probably damaging Het
Vmn1r50 T A 6: 90,107,837 M188K probably benign Het
Vps11 G A 9: 44,355,079 T437I probably damaging Het
Xrn1 C T 9: 96,047,790 T1498I probably benign Het
Zfp236 A G 18: 82,691,576 probably null Het
Zfp316 T C 5: 143,263,355 D175G unknown Het
Zmynd11 A G 13: 9,694,330 L256P probably damaging Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 32967814 splice site probably null
IGL01019:Depdc5 APN 5 32893401 missense probably damaging 0.96
IGL01067:Depdc5 APN 5 32899067 splice site probably null
IGL01405:Depdc5 APN 5 32937689 missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 32955897 missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 32924200 missense probably damaging 1.00
IGL01998:Depdc5 APN 5 32945151 splice site probably benign
IGL02025:Depdc5 APN 5 32946632 critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 32903801 missense probably damaging 1.00
IGL02537:Depdc5 APN 5 32967787 missense probably damaging 1.00
IGL02812:Depdc5 APN 5 32893368 splice site probably benign
IGL03001:Depdc5 APN 5 32945090 missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 32868813 unclassified probably benign
IGL02988:Depdc5 UTSW 5 32956167 splice site probably null
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0153:Depdc5 UTSW 5 32933937 splice site probably benign
R0179:Depdc5 UTSW 5 32901574 unclassified probably benign
R0212:Depdc5 UTSW 5 32912242 missense probably benign 0.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0302:Depdc5 UTSW 5 32904546 critical splice donor site probably benign
R0511:Depdc5 UTSW 5 32945028 nonsense probably null
R0677:Depdc5 UTSW 5 32901470 missense probably damaging 1.00
R0884:Depdc5 UTSW 5 32917978 missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 32986966 missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 32877074 missense probably damaging 1.00
R1611:Depdc5 UTSW 5 32990953 missense probably damaging 1.00
R1687:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 32917942 missense probably benign 0.24
R1903:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 32903831 missense probably damaging 1.00
R1997:Depdc5 UTSW 5 32901906 critical splice donor site probably null
R2079:Depdc5 UTSW 5 32946674 missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 32990781 nonsense probably null
R2291:Depdc5 UTSW 5 32979402 missense probably damaging 1.00
R2422:Depdc5 UTSW 5 32991035 missense probably damaging 1.00
R2851:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2852:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2937:Depdc5 UTSW 5 32901621 splice site probably null
R2938:Depdc5 UTSW 5 32901621 splice site probably null
R2974:Depdc5 UTSW 5 32934017 critical splice donor site probably null
R3884:Depdc5 UTSW 5 32944077 missense probably damaging 1.00
R3967:Depdc5 UTSW 5 32944115 nonsense probably null
R4118:Depdc5 UTSW 5 32964635 missense probably damaging 1.00
R4197:Depdc5 UTSW 5 32991203 missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 32904534 critical splice donor site probably null
R4534:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 32983946 missense probably damaging 1.00
R4613:Depdc5 UTSW 5 32975446 missense probably damaging 1.00
R4736:Depdc5 UTSW 5 32975322 missense probably benign
R4738:Depdc5 UTSW 5 32975322 missense probably benign
R4765:Depdc5 UTSW 5 32937635 missense probably damaging 1.00
R5021:Depdc5 UTSW 5 32979414 missense probably damaging 1.00
R5259:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5261:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5541:Depdc5 UTSW 5 32864629 utr 5 prime probably benign
R5594:Depdc5 UTSW 5 32901490 missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 32975506 nonsense probably null
R6132:Depdc5 UTSW 5 32910467 missense probably damaging 0.99
R6146:Depdc5 UTSW 5 32968731 missense probably benign 0.01
R6336:Depdc5 UTSW 5 32964507 splice site probably null
R6468:Depdc5 UTSW 5 32912231 missense probably benign 0.02
R6911:Depdc5 UTSW 5 32924192 missense probably damaging 1.00
R6969:Depdc5 UTSW 5 32983860 missense probably damaging 1.00
R7066:Depdc5 UTSW 5 32901848 missense probably benign 0.08
R7231:Depdc5 UTSW 5 32901865 missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 32967745 missense probably benign
R7302:Depdc5 UTSW 5 32979508 missense probably damaging 1.00
R7386:Depdc5 UTSW 5 32927936 missense probably benign
R7564:Depdc5 UTSW 5 32901510 missense probably damaging 1.00
R7636:Depdc5 UTSW 5 32917983 missense probably benign
R7795:Depdc5 UTSW 5 32944103 missense probably damaging 1.00
R7845:Depdc5 UTSW 5 32903915 splice site probably null
R8013:Depdc5 UTSW 5 32973842 missense probably benign 0.01
R8037:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8038:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8065:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 32945049 missense probably benign 0.01
R8112:Depdc5 UTSW 5 32968706 missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 32937637 missense probably damaging 1.00
R8382:Depdc5 UTSW 5 32927898 missense probably benign 0.00
R8680:Depdc5 UTSW 5 32944038 missense possibly damaging 0.48
R8743:Depdc5 UTSW 5 32924243 missense probably benign 0.10
R8754:Depdc5 UTSW 5 32979537 missense probably benign 0.00
X0027:Depdc5 UTSW 5 32904292 missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 32943282 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGTGCTCTCCCAAAGGTTTTC -3'
(R):5'- GACTTGGAACTTATTTTGATGGCTC -3'

Sequencing Primer
(F):5'- TATGGTGTGTGGCCATCA -3'
(R):5'- TACAGAGTGAGTTCCAGG -3'
Posted On2019-08-05