Incidental Mutation 'R7002:Depdc5'
ID 568481
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene Name DEP domain containing 5
Synonyms
MMRRC Submission 045107-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7002 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 33021045-33151580 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 33034502 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000118698] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000125574] [ENSMUST00000149350] [ENSMUST00000195980]
AlphaFold P61460
Predicted Effect probably null
Transcript: ENSMUST00000049780
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000087897
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118698
SMART Domains Protein: ENSMUSP00000112906
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 205 1.9e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119705
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120902
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000125574
SMART Domains Protein: ENSMUSP00000122173
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 137 6.9e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149350
SMART Domains Protein: ENSMUSP00000122461
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 161 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195980
SMART Domains Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 147 4e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,832,390 (GRCm39) S1308P probably damaging Het
Abl2 A T 1: 156,386,703 (GRCm39) R29W probably damaging Het
Adam6b C A 12: 113,453,327 (GRCm39) S48* probably null Het
Adamts18 T A 8: 114,501,922 (GRCm39) D313V possibly damaging Het
Aoc1 A G 6: 48,882,810 (GRCm39) S229G probably benign Het
Apol10a G A 15: 77,369,046 (GRCm39) R15H possibly damaging Het
Bend4 T A 5: 67,555,602 (GRCm39) T535S probably benign Het
Blm T C 7: 80,119,501 (GRCm39) K1024R probably benign Het
Brca2 T C 5: 150,463,383 (GRCm39) V1049A probably benign Het
Cerk T C 15: 86,040,795 (GRCm39) Y188C possibly damaging Het
Cic C T 7: 24,971,621 (GRCm39) R451C probably damaging Het
Col18a1 A T 10: 77,002,177 (GRCm39) V10E unknown Het
Cplx1 T A 5: 108,668,182 (GRCm39) K58M probably damaging Het
Crybg1 T A 10: 43,874,831 (GRCm39) D759V probably damaging Het
Cwc25 A T 11: 97,638,897 (GRCm39) N342K probably damaging Het
Dab2 A T 15: 6,464,846 (GRCm39) T566S probably benign Het
Dip2b T A 15: 100,058,346 (GRCm39) N408K probably benign Het
Dnah12 T C 14: 26,598,955 (GRCm39) I3631T probably damaging Het
Dnase1 A G 16: 3,857,410 (GRCm39) I236V possibly damaging Het
Duox1 C T 2: 122,150,358 (GRCm39) Q196* probably null Het
Eef2k G A 7: 120,491,155 (GRCm39) R547Q probably benign Het
Erich5 C T 15: 34,471,508 (GRCm39) L246F probably damaging Het
Frmpd1 C T 4: 45,284,200 (GRCm39) A1007V probably benign Het
Fsip2 T A 2: 82,819,687 (GRCm39) I5140N possibly damaging Het
Gan T C 8: 117,922,586 (GRCm39) C440R possibly damaging Het
Garnl3 T A 2: 32,944,205 (GRCm39) H73L possibly damaging Het
Gid8 T G 2: 180,355,096 (GRCm39) M34R possibly damaging Het
Gjd4 C A 18: 9,280,960 (GRCm39) L39F possibly damaging Het
Gpatch2l G A 12: 86,290,958 (GRCm39) R47H probably damaging Het
Grhpr T C 4: 44,990,427 (GRCm39) S306P probably damaging Het
H2bc21 A G 3: 96,128,689 (GRCm39) I70V probably benign Het
Hdac4 T G 1: 91,896,083 (GRCm39) K729T possibly damaging Het
Igfbp2 C T 1: 72,888,804 (GRCm39) H85Y probably damaging Het
Igkv4-61 T G 6: 69,394,373 (GRCm39) I13L probably benign Het
Il18r1 G A 1: 40,514,013 (GRCm39) S73N probably benign Het
Immt T C 6: 71,838,024 (GRCm39) V244A probably damaging Het
Irs1 T C 1: 82,265,981 (GRCm39) Y745C probably benign Het
Itpr3 T C 17: 27,329,554 (GRCm39) V1526A probably benign Het
Jrkl A T 9: 13,245,526 (GRCm39) I45K probably damaging Het
Lamp3 G T 16: 19,474,172 (GRCm39) Q401K possibly damaging Het
Lrrfip1 T A 1: 91,043,180 (GRCm39) H528Q probably benign Het
Ltn1 A T 16: 87,220,361 (GRCm39) D245E probably benign Het
Mmut T A 17: 41,252,274 (GRCm39) I272N possibly damaging Het
Mnat1 T C 12: 73,277,479 (GRCm39) probably benign Het
Mprip A C 11: 59,652,016 (GRCm39) M1907L probably benign Het
Nfu1 C A 6: 86,993,254 (GRCm39) H131Q probably benign Het
Nup188 T A 2: 30,213,580 (GRCm39) S670R probably damaging Het
Or5b120 A G 19: 13,480,039 (GRCm39) N111D probably benign Het
Or8k40 T C 2: 86,585,025 (GRCm39) D19G probably benign Het
Pals2 C T 6: 50,139,642 (GRCm39) P116L probably benign Het
Parp4 T A 14: 56,839,861 (GRCm39) V523E probably damaging Het
Pbrm1 T A 14: 30,786,777 (GRCm39) D631E probably benign Het
Prss40 A T 1: 34,591,481 (GRCm39) probably null Het
Rnf13 A G 3: 57,741,033 (GRCm39) N274S probably damaging Het
Rtl1 T A 12: 109,560,381 (GRCm39) Y486F probably damaging Het
Sec14l3 A T 11: 4,025,263 (GRCm39) H291L possibly damaging Het
Senp5 A G 16: 31,802,593 (GRCm39) S532P probably damaging Het
Sepsecs T C 5: 52,804,550 (GRCm39) probably null Het
Serpina1e T C 12: 103,914,338 (GRCm39) I329V probably benign Het
Slc10a4-ps T A 5: 72,743,763 (GRCm39) probably null Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,773 (GRCm39) unknown Het
Smc5 A G 19: 23,209,247 (GRCm39) V639A probably benign Het
Speg T A 1: 75,399,912 (GRCm39) V2453E probably damaging Het
Syt2 T A 1: 134,671,842 (GRCm39) F207I probably damaging Het
Tchp C T 5: 114,846,857 (GRCm39) S48L probably benign Het
Trim12a A G 7: 103,953,383 (GRCm39) S243P possibly damaging Het
Ttn T C 2: 76,628,561 (GRCm39) E14533G probably damaging Het
Vmn1r50 T A 6: 90,084,819 (GRCm39) M188K probably benign Het
Vps11 G A 9: 44,266,376 (GRCm39) T437I probably damaging Het
Xrn1 C T 9: 95,929,843 (GRCm39) T1498I probably benign Het
Zfp236 A G 18: 82,709,701 (GRCm39) probably null Het
Zfp316 T C 5: 143,249,110 (GRCm39) D175G unknown Het
Zmynd11 A G 13: 9,744,366 (GRCm39) L256P probably damaging Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 33,125,158 (GRCm39) splice site probably null
IGL01019:Depdc5 APN 5 33,050,745 (GRCm39) missense probably damaging 0.96
IGL01067:Depdc5 APN 5 33,056,411 (GRCm39) splice site probably null
IGL01405:Depdc5 APN 5 33,095,033 (GRCm39) missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 33,113,241 (GRCm39) missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 33,081,544 (GRCm39) missense probably damaging 1.00
IGL01998:Depdc5 APN 5 33,102,495 (GRCm39) splice site probably benign
IGL02025:Depdc5 APN 5 33,103,976 (GRCm39) critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 33,061,145 (GRCm39) missense probably damaging 1.00
IGL02537:Depdc5 APN 5 33,125,131 (GRCm39) missense probably damaging 1.00
IGL02812:Depdc5 APN 5 33,050,712 (GRCm39) splice site probably benign
IGL03001:Depdc5 APN 5 33,102,434 (GRCm39) missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 33,026,157 (GRCm39) unclassified probably benign
alligator UTSW 5 33,121,851 (GRCm39) splice site probably null
lagarto UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
sauros UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
IGL02988:Depdc5 UTSW 5 33,113,511 (GRCm39) splice site probably null
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0153:Depdc5 UTSW 5 33,091,281 (GRCm39) splice site probably benign
R0179:Depdc5 UTSW 5 33,058,918 (GRCm39) unclassified probably benign
R0212:Depdc5 UTSW 5 33,069,586 (GRCm39) missense probably benign 0.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0302:Depdc5 UTSW 5 33,061,890 (GRCm39) critical splice donor site probably benign
R0511:Depdc5 UTSW 5 33,102,372 (GRCm39) nonsense probably null
R0677:Depdc5 UTSW 5 33,058,814 (GRCm39) missense probably damaging 1.00
R0884:Depdc5 UTSW 5 33,075,322 (GRCm39) missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 33,034,418 (GRCm39) missense probably damaging 1.00
R1611:Depdc5 UTSW 5 33,148,297 (GRCm39) missense probably damaging 1.00
R1687:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 33,075,286 (GRCm39) missense probably benign 0.24
R1903:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 33,061,175 (GRCm39) missense probably damaging 1.00
R1997:Depdc5 UTSW 5 33,059,250 (GRCm39) critical splice donor site probably null
R2079:Depdc5 UTSW 5 33,104,018 (GRCm39) missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 33,148,125 (GRCm39) nonsense probably null
R2291:Depdc5 UTSW 5 33,136,746 (GRCm39) missense probably damaging 1.00
R2422:Depdc5 UTSW 5 33,148,379 (GRCm39) missense probably damaging 1.00
R2851:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2852:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2937:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2938:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2974:Depdc5 UTSW 5 33,091,361 (GRCm39) critical splice donor site probably null
R3884:Depdc5 UTSW 5 33,101,421 (GRCm39) missense probably damaging 1.00
R3967:Depdc5 UTSW 5 33,101,459 (GRCm39) nonsense probably null
R4118:Depdc5 UTSW 5 33,121,979 (GRCm39) missense probably damaging 1.00
R4197:Depdc5 UTSW 5 33,148,547 (GRCm39) missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 33,061,878 (GRCm39) critical splice donor site probably null
R4534:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 33,141,290 (GRCm39) missense probably damaging 1.00
R4613:Depdc5 UTSW 5 33,132,790 (GRCm39) missense probably damaging 1.00
R4736:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4738:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4765:Depdc5 UTSW 5 33,094,979 (GRCm39) missense probably damaging 1.00
R5021:Depdc5 UTSW 5 33,136,758 (GRCm39) missense probably damaging 1.00
R5259:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5261:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5541:Depdc5 UTSW 5 33,021,973 (GRCm39) utr 5 prime probably benign
R5594:Depdc5 UTSW 5 33,058,834 (GRCm39) missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 33,132,850 (GRCm39) nonsense probably null
R6132:Depdc5 UTSW 5 33,067,811 (GRCm39) missense probably damaging 0.99
R6146:Depdc5 UTSW 5 33,126,075 (GRCm39) missense probably benign 0.01
R6336:Depdc5 UTSW 5 33,121,851 (GRCm39) splice site probably null
R6468:Depdc5 UTSW 5 33,069,575 (GRCm39) missense probably benign 0.02
R6911:Depdc5 UTSW 5 33,081,536 (GRCm39) missense probably damaging 1.00
R6969:Depdc5 UTSW 5 33,141,204 (GRCm39) missense probably damaging 1.00
R7066:Depdc5 UTSW 5 33,059,192 (GRCm39) missense probably benign 0.08
R7231:Depdc5 UTSW 5 33,059,209 (GRCm39) missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 33,125,089 (GRCm39) missense probably benign
R7302:Depdc5 UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
R7386:Depdc5 UTSW 5 33,085,280 (GRCm39) missense probably benign
R7564:Depdc5 UTSW 5 33,058,854 (GRCm39) missense probably damaging 1.00
R7636:Depdc5 UTSW 5 33,075,327 (GRCm39) missense probably benign
R7795:Depdc5 UTSW 5 33,101,447 (GRCm39) missense probably damaging 1.00
R7845:Depdc5 UTSW 5 33,061,259 (GRCm39) splice site probably null
R8013:Depdc5 UTSW 5 33,131,186 (GRCm39) missense probably benign 0.01
R8037:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8038:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8065:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 33,102,393 (GRCm39) missense probably benign 0.01
R8112:Depdc5 UTSW 5 33,126,050 (GRCm39) missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 33,094,981 (GRCm39) missense probably damaging 1.00
R8382:Depdc5 UTSW 5 33,085,242 (GRCm39) missense probably benign 0.00
R8680:Depdc5 UTSW 5 33,101,382 (GRCm39) missense possibly damaging 0.48
R8743:Depdc5 UTSW 5 33,081,587 (GRCm39) missense probably benign 0.10
R8754:Depdc5 UTSW 5 33,136,881 (GRCm39) missense probably benign 0.00
R9157:Depdc5 UTSW 5 33,102,452 (GRCm39) missense probably damaging 0.98
R9364:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9441:Depdc5 UTSW 5 33,095,042 (GRCm39) missense probably benign 0.03
R9450:Depdc5 UTSW 5 33,091,354 (GRCm39) missense probably benign
R9459:Depdc5 UTSW 5 33,148,117 (GRCm39) missense probably damaging 0.99
R9554:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9569:Depdc5 UTSW 5 33,025,321 (GRCm39) missense probably damaging 0.98
R9647:Depdc5 UTSW 5 33,081,567 (GRCm39) missense possibly damaging 0.94
R9688:Depdc5 UTSW 5 33,055,276 (GRCm39) nonsense probably null
X0027:Depdc5 UTSW 5 33,061,636 (GRCm39) missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 33,100,626 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGTGCTCTCCCAAAGGTTTTC -3'
(R):5'- GACTTGGAACTTATTTTGATGGCTC -3'

Sequencing Primer
(F):5'- TATGGTGTGTGGCCATCA -3'
(R):5'- TACAGAGTGAGTTCCAGG -3'
Posted On 2019-08-05