Mutagenetix > Incidental Mutations

Incidental Mutation 'R7088:Shank3'

568483

Institutional Source

Beutler Lab

Gene Symbol

Shank3

Ensembl Gene

ENSMUSG00000022623

Gene Name

SH3 and multiple ankyrin repeat domains 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.298) question?

Stock #

R7088 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89499623-89560261 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 89503525 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000104932 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039074] [ENSMUST00000109309]

Predicted Effect

probably null
Transcript: ENSMUST00000039074

SMART Domains

Protein: ENSMUSP00000048062
Gene: ENSMUSG00000022623

Domain	Start	End	E-Value	Type
ANK	182	211	1.54e-1	SMART
ANK	215	245	3.36e2	SMART
ANK	249	278	2.47e0	SMART
ANK	282	311	3.71e-4	SMART
ANK	315	345	5.03e2	SMART
low complexity region	434	462	N/A	INTRINSIC
SH3	473	528	1.28e-14	SMART
PDZ	579	664	3.95e-13	SMART
low complexity region	672	684	N/A	INTRINSIC
low complexity region	813	843	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	905	923	N/A	INTRINSIC
low complexity region	1078	1092	N/A	INTRINSIC
low complexity region	1109	1121	N/A	INTRINSIC
low complexity region	1173	1194	N/A	INTRINSIC
low complexity region	1235	1252	N/A	INTRINSIC
low complexity region	1266	1278	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1341	1355	N/A	INTRINSIC
low complexity region	1370	1395	N/A	INTRINSIC
low complexity region	1409	1427	N/A	INTRINSIC
low complexity region	1552	1558	N/A	INTRINSIC
low complexity region	1584	1599	N/A	INTRINSIC
low complexity region	1626	1658	N/A	INTRINSIC
SAM	1664	1730	3.08e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000109309

SMART Domains

Protein: ENSMUSP00000104932
Gene: ENSMUSG00000022623

Domain	Start	End	E-Value	Type
low complexity region	5	55	N/A	INTRINSIC
Pfam:FERM_f0	84	167	2.5e-14	PFAM
ANK	257	286	1.54e-1	SMART
ANK	290	320	3.36e2	SMART
ANK	324	353	2.47e0	SMART
ANK	357	386	3.71e-4	SMART
ANK	390	420	5.03e2	SMART
low complexity region	509	537	N/A	INTRINSIC
SH3	548	603	1.28e-14	SMART
PDZ	654	739	3.95e-13	SMART
low complexity region	747	759	N/A	INTRINSIC
low complexity region	888	918	N/A	INTRINSIC
low complexity region	932	944	N/A	INTRINSIC
low complexity region	980	998	N/A	INTRINSIC
low complexity region	1153	1167	N/A	INTRINSIC
low complexity region	1184	1196	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1310	1327	N/A	INTRINSIC
low complexity region	1341	1353	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1416	1430	N/A	INTRINSIC
low complexity region	1445	1470	N/A	INTRINSIC
low complexity region	1484	1502	N/A	INTRINSIC
low complexity region	1627	1633	N/A	INTRINSIC
low complexity region	1659	1674	N/A	INTRINSIC
low complexity region	1701	1733	N/A	INTRINSIC
SAM	1739	1805	3.08e-18	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying various deletions of exons encoding the ankyrin repeats (exons 4-9) exhibit a range of synaptic and autism-related impairments. Homozygotes lacking exon 9 show altered excitation/inhibition balance, increased rearing, and mildly impaired spatial memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L24Rik	G	T	11: 83,440,406	E48*	probably null	Het
2410089E03Rik	C	T	15: 8,218,947	T1660M	probably benign	Het
5830473C10Rik	T	A	5: 90,572,750	L260*	probably null	Het
Acaca	T	C	11: 84,278,957		probably null	Het
AI314180	A	T	4: 58,849,766	L458I	possibly damaging	Het
Alkbh3	A	G	2: 94,004,752	S83P	possibly damaging	Het
Ammecr1l	T	C	18: 31,771,819	S38P	probably benign	Het
Armc10	T	C	5: 21,653,392	V145A	probably damaging	Het
BC048671	A	G	6: 90,303,240	K46R	probably null	Het
C2cd3	A	G	7: 100,416,181	T347A		Het
C8b	G	T	4: 104,793,343	E449D	probably benign	Het
Camk4	T	C	18: 32,939,531	S46P	probably benign	Het
Ccdc113	G	A	8: 95,538,105	R81H	probably benign	Het
Cd177	A	T	7: 24,745,133	C674*	probably null	Het
Cdc6	T	A	11: 98,919,239	V458D	probably damaging	Het
Cenpo	C	T	12: 4,215,307	E238K	probably benign	Het
Ckap2	G	T	8: 22,169,866	P533Q	possibly damaging	Het
Cma1	T	A	14: 55,943,816	H44L	probably damaging	Het
Cmya5	A	T	13: 93,091,864	S2239T	possibly damaging	Het
Cntnap5b	T	A	1: 100,160,077	I141N	probably damaging	Het
Col6a4	T	A	9: 106,000,686	T2031S	possibly damaging	Het
Cxcr5	T	A	9: 44,513,386	T325S	possibly damaging	Het
Dhx32	A	T	7: 133,742,688	L204Q	probably damaging	Het
Dse	A	G	10: 34,153,889	Y402H	probably damaging	Het
Exoc6	G	T	19: 37,577,010	C178F	probably damaging	Het
Fam149a	A	G	8: 45,350,545	V384A	probably benign	Het
Fcrl5	T	C	3: 87,457,834	*597Q	probably null	Het
Fer1l6	A	G	15: 58,564,050	K431E	possibly damaging	Het
Fmo3	T	A	1: 162,968,865	H46L	probably benign	Het
Gcm2	T	C	13: 41,103,364	D303G	probably damaging	Het
Gk2	T	C	5: 97,455,675	M435V	probably damaging	Het
Gli1	C	A	10: 127,335,999	M295I	probably damaging	Het
Gm11444	G	T	11: 85,847,036	H109Q		Het
Gtpbp1	T	A	15: 79,719,282	D182E		Het
Hnf4g	A	T	3: 3,648,125		probably null	Het
Hsf2	G	A	10: 57,512,092	R483H	probably damaging	Het
Kcnq4	C	T	4: 120,704,399	R491H	probably damaging	Het
Lama3	T	C	18: 12,582,545	V1686A	possibly damaging	Het
Larp6	A	G	9: 60,724,355	K137E	probably damaging	Het
Mboat1	T	G	13: 30,195,789		probably null	Het
Mdh1	T	C	11: 21,558,484	Y286C	probably damaging	Het
Mga	G	T	2: 119,961,936	K2607N	probably damaging	Het
Morf4l1	C	A	9: 90,097,380	V183F	possibly damaging	Het
Mroh4	G	A	15: 74,626,144	R196W	probably benign	Het
Muc16	C	A	9: 18,592,680	M6438I	probably damaging	Het
Myom3	A	G	4: 135,803,278	Y1167C	probably damaging	Het
Neurl3	T	C	1: 36,269,221	E170G	possibly damaging	Het
Nsd3	T	C	8: 25,666,034	I539T	probably benign	Het
Nup155	T	C	15: 8,156,693	F1313S	probably benign	Het
Nxn	A	T	11: 76,263,148	V287E	possibly damaging	Het
Olfr1253	G	A	2: 89,752,099	T243I	probably benign	Het
Olfr1354	A	C	10: 78,917,759	L306F	probably benign	Het
Olfr891	C	A	9: 38,180,452	V124F	probably damaging	Het
Pax6	A	G	2: 105,696,408	N220D	probably benign	Het
Pcdha11	G	A	18: 37,005,417	R33H	probably benign	Het
Pdzd8	A	G	19: 59,344,957	F211L	probably damaging	Het
Pear1	C	A	3: 87,754,638	V477F	possibly damaging	Het
Pex19	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC	1: 172,128,583		probably null	Het
Pidd1	A	T	7: 141,440,487	V539E	probably damaging	Het
Ptprg	A	T	14: 12,207,365	I878F	probably damaging	Het
Rabepk	T	C	2: 34,785,699	T140A	probably benign	Het
Ranbp2	G	T	10: 58,463,906	R454L	probably damaging	Het
Rnf123	C	T	9: 108,058,536	R943Q	probably null	Het
Sash1	G	A	10: 8,729,717	R970*	probably null	Het
Serpinb2	C	A	1: 107,524,692	F333L	probably damaging	Het
Slc9a2	A	C	1: 40,726,379	I310L	probably damaging	Het
Strip2	T	A	6: 29,920,533		probably null	Het
Thoc3	T	C	13: 54,463,752	T241A	probably damaging	Het
Tmem139	T	A	6: 42,263,265	V2E	probably damaging	Het
Usp24	G	T	4: 106,387,546	V1233F	probably damaging	Het
Vnn1	A	G	10: 23,900,747	Q332R	probably benign	Het
Wac	T	A	18: 7,921,455	H530Q	probably damaging	Het
Wdr35	T	A	12: 8,978,659	N92K	probably benign	Het
Zbtb18	T	G	1: 177,447,254	L60R	probably damaging	Het
Zfp184	T	A	13: 21,959,992	C623S	probably damaging	Het
Zfp292	A	G	4: 34,806,796	Y2088H	probably damaging	Het
Zfp975	G	T	7: 42,662,672	S172R	probably benign	Het
Zswim2	G	A	2: 83,915,727	Q456*	probably null	Het

Other mutations in Shank3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01070:Shank3	APN	15	89549416	missense	probably damaging	1.00
IGL01469:Shank3	APN	15	89521274	missense	probably damaging	1.00
IGL01886:Shank3	APN	15	89531663	missense	probably damaging	1.00
IGL01934:Shank3	APN	15	89549846	missense	probably damaging	1.00
IGL01989:Shank3	APN	15	89503299	splice site	probably benign
IGL02004:Shank3	APN	15	89503299	splice site	probably benign
IGL02085:Shank3	APN	15	89503915	critical splice donor site	probably null
IGL02195:Shank3	APN	15	89548118	missense	probably damaging	1.00
IGL02354:Shank3	APN	15	89504333	missense	probably damaging	1.00
IGL02361:Shank3	APN	15	89504333	missense	probably damaging	1.00
IGL02541:Shank3	APN	15	89501410	missense	probably damaging	1.00
R0294:Shank3	UTSW	15	89532098	missense	probably damaging	1.00
R0468:Shank3	UTSW	15	89549275	missense	probably benign	0.28
R0483:Shank3	UTSW	15	89543239	splice site	probably benign
R0605:Shank3	UTSW	15	89524147	missense	possibly damaging	0.49
R0675:Shank3	UTSW	15	89531388	missense	possibly damaging	0.92
R1082:Shank3	UTSW	15	89549371	missense	probably damaging	1.00
R1576:Shank3	UTSW	15	89503663	missense	probably benign	0.11
R1702:Shank3	UTSW	15	89499896	missense	probably damaging	0.99
R1726:Shank3	UTSW	15	89557986	missense	probably damaging	1.00
R1958:Shank3	UTSW	15	89503148	missense	probably damaging	0.99
R1961:Shank3	UTSW	15	89557964	missense	possibly damaging	0.60
R2420:Shank3	UTSW	15	89521210	nonsense	probably null
R2513:Shank3	UTSW	15	89548686	missense	probably benign	0.05
R3917:Shank3	UTSW	15	89503384	missense	possibly damaging	0.77
R4163:Shank3	UTSW	15	89549594	missense	probably damaging	1.00
R4205:Shank3	UTSW	15	89503318	missense	probably damaging	1.00
R4434:Shank3	UTSW	15	89503359	missense	probably damaging	1.00
R4791:Shank3	UTSW	15	89500354	missense	probably damaging	1.00
R4816:Shank3	UTSW	15	89543115	missense	probably damaging	1.00
R4828:Shank3	UTSW	15	89500199	intron	probably benign
R4911:Shank3	UTSW	15	89504344	missense	probably damaging	1.00
R4997:Shank3	UTSW	15	89549698	missense	probably damaging	1.00
R5213:Shank3	UTSW	15	89533278	missense	possibly damaging	0.82
R5338:Shank3	UTSW	15	89531711	splice site	probably null
R5494:Shank3	UTSW	15	89548238	missense	probably damaging	0.99
R5543:Shank3	UTSW	15	89532354	missense	probably damaging	1.00
R5654:Shank3	UTSW	15	89521326	missense	probably benign	0.07
R5900:Shank3	UTSW	15	89503390	missense	probably damaging	1.00
R5906:Shank3	UTSW	15	89548916	missense	probably damaging	1.00
R6385:Shank3	UTSW	15	89521375	critical splice donor site	probably null
R6432:Shank3	UTSW	15	89503413	missense	possibly damaging	0.75
R6724:Shank3	UTSW	15	89532453	missense	probably damaging	1.00
R6822:Shank3	UTSW	15	89531627	missense	probably damaging	1.00
R6845:Shank3	UTSW	15	89548325	missense	probably benign	0.00
R7390:Shank3	UTSW	15	89549312	missense	probably benign	0.05
R7808:Shank3	UTSW	15	89548880	missense	probably damaging	1.00
R7862:Shank3	UTSW	15	89505445	missense	possibly damaging	0.73
R7945:Shank3	UTSW	15	89505445	missense	possibly damaging	0.73
RF020:Shank3	UTSW	15	89500390	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- TATGTCCCATTCCAGAGTGCCC -3'
(R):5'- TGCCAACCATTCTCATCAGTG -3'

Sequencing Primer
(F):5'- TTGCGGCACAGTTGGACAAC -3'
(R):5'- TCATCAGTGGTCCCCAGCTG -3'

Posted On

2019-08-05