Incidental Mutation 'R7088:Shank3'
ID568483
Institutional Source Beutler Lab
Gene Symbol Shank3
Ensembl Gene ENSMUSG00000022623
Gene NameSH3 and multiple ankyrin repeat domains 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R7088 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89499623-89560261 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 89503525 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039074] [ENSMUST00000109309]
Predicted Effect probably null
Transcript: ENSMUST00000039074
SMART Domains Protein: ENSMUSP00000048062
Gene: ENSMUSG00000022623

DomainStartEndE-ValueType
ANK 182 211 1.54e-1 SMART
ANK 215 245 3.36e2 SMART
ANK 249 278 2.47e0 SMART
ANK 282 311 3.71e-4 SMART
ANK 315 345 5.03e2 SMART
low complexity region 434 462 N/A INTRINSIC
SH3 473 528 1.28e-14 SMART
PDZ 579 664 3.95e-13 SMART
low complexity region 672 684 N/A INTRINSIC
low complexity region 813 843 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 905 923 N/A INTRINSIC
low complexity region 1078 1092 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1173 1194 N/A INTRINSIC
low complexity region 1235 1252 N/A INTRINSIC
low complexity region 1266 1278 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1370 1395 N/A INTRINSIC
low complexity region 1409 1427 N/A INTRINSIC
low complexity region 1552 1558 N/A INTRINSIC
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1626 1658 N/A INTRINSIC
SAM 1664 1730 3.08e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109309
SMART Domains Protein: ENSMUSP00000104932
Gene: ENSMUSG00000022623

DomainStartEndE-ValueType
low complexity region 5 55 N/A INTRINSIC
Pfam:FERM_f0 84 167 2.5e-14 PFAM
ANK 257 286 1.54e-1 SMART
ANK 290 320 3.36e2 SMART
ANK 324 353 2.47e0 SMART
ANK 357 386 3.71e-4 SMART
ANK 390 420 5.03e2 SMART
low complexity region 509 537 N/A INTRINSIC
SH3 548 603 1.28e-14 SMART
PDZ 654 739 3.95e-13 SMART
low complexity region 747 759 N/A INTRINSIC
low complexity region 888 918 N/A INTRINSIC
low complexity region 932 944 N/A INTRINSIC
low complexity region 980 998 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
low complexity region 1184 1196 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1310 1327 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1416 1430 N/A INTRINSIC
low complexity region 1445 1470 N/A INTRINSIC
low complexity region 1484 1502 N/A INTRINSIC
low complexity region 1627 1633 N/A INTRINSIC
low complexity region 1659 1674 N/A INTRINSIC
low complexity region 1701 1733 N/A INTRINSIC
SAM 1739 1805 3.08e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying various deletions of exons encoding the ankyrin repeats (exons 4-9) exhibit a range of synaptic and autism-related impairments. Homozygotes lacking exon 9 show altered excitation/inhibition balance, increased rearing, and mildly impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
2410089E03Rik C T 15: 8,218,947 T1660M probably benign Het
5830473C10Rik T A 5: 90,572,750 L260* probably null Het
Acaca T C 11: 84,278,957 probably null Het
AI314180 A T 4: 58,849,766 L458I possibly damaging Het
Alkbh3 A G 2: 94,004,752 S83P possibly damaging Het
Ammecr1l T C 18: 31,771,819 S38P probably benign Het
Armc10 T C 5: 21,653,392 V145A probably damaging Het
BC048671 A G 6: 90,303,240 K46R probably null Het
C2cd3 A G 7: 100,416,181 T347A Het
C8b G T 4: 104,793,343 E449D probably benign Het
Camk4 T C 18: 32,939,531 S46P probably benign Het
Ccdc113 G A 8: 95,538,105 R81H probably benign Het
Cd177 A T 7: 24,745,133 C674* probably null Het
Cdc6 T A 11: 98,919,239 V458D probably damaging Het
Cenpo C T 12: 4,215,307 E238K probably benign Het
Ckap2 G T 8: 22,169,866 P533Q possibly damaging Het
Cma1 T A 14: 55,943,816 H44L probably damaging Het
Cmya5 A T 13: 93,091,864 S2239T possibly damaging Het
Cntnap5b T A 1: 100,160,077 I141N probably damaging Het
Col6a4 T A 9: 106,000,686 T2031S possibly damaging Het
Cxcr5 T A 9: 44,513,386 T325S possibly damaging Het
Dhx32 A T 7: 133,742,688 L204Q probably damaging Het
Dse A G 10: 34,153,889 Y402H probably damaging Het
Exoc6 G T 19: 37,577,010 C178F probably damaging Het
Fam149a A G 8: 45,350,545 V384A probably benign Het
Fcrl5 T C 3: 87,457,834 *597Q probably null Het
Fer1l6 A G 15: 58,564,050 K431E possibly damaging Het
Fmo3 T A 1: 162,968,865 H46L probably benign Het
Gcm2 T C 13: 41,103,364 D303G probably damaging Het
Gk2 T C 5: 97,455,675 M435V probably damaging Het
Gli1 C A 10: 127,335,999 M295I probably damaging Het
Gm11444 G T 11: 85,847,036 H109Q Het
Gtpbp1 T A 15: 79,719,282 D182E Het
Hnf4g A T 3: 3,648,125 probably null Het
Hsf2 G A 10: 57,512,092 R483H probably damaging Het
Kcnq4 C T 4: 120,704,399 R491H probably damaging Het
Lama3 T C 18: 12,582,545 V1686A possibly damaging Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Mboat1 T G 13: 30,195,789 probably null Het
Mdh1 T C 11: 21,558,484 Y286C probably damaging Het
Mga G T 2: 119,961,936 K2607N probably damaging Het
Morf4l1 C A 9: 90,097,380 V183F possibly damaging Het
Mroh4 G A 15: 74,626,144 R196W probably benign Het
Muc16 C A 9: 18,592,680 M6438I probably damaging Het
Myom3 A G 4: 135,803,278 Y1167C probably damaging Het
Neurl3 T C 1: 36,269,221 E170G possibly damaging Het
Nsd3 T C 8: 25,666,034 I539T probably benign Het
Nup155 T C 15: 8,156,693 F1313S probably benign Het
Nxn A T 11: 76,263,148 V287E possibly damaging Het
Olfr1253 G A 2: 89,752,099 T243I probably benign Het
Olfr1354 A C 10: 78,917,759 L306F probably benign Het
Olfr891 C A 9: 38,180,452 V124F probably damaging Het
Pax6 A G 2: 105,696,408 N220D probably benign Het
Pcdha11 G A 18: 37,005,417 R33H probably benign Het
Pdzd8 A G 19: 59,344,957 F211L probably damaging Het
Pear1 C A 3: 87,754,638 V477F possibly damaging Het
Pex19 GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC 1: 172,128,583 probably null Het
Pidd1 A T 7: 141,440,487 V539E probably damaging Het
Ptprg A T 14: 12,207,365 I878F probably damaging Het
Rabepk T C 2: 34,785,699 T140A probably benign Het
Ranbp2 G T 10: 58,463,906 R454L probably damaging Het
Rnf123 C T 9: 108,058,536 R943Q probably null Het
Sash1 G A 10: 8,729,717 R970* probably null Het
Serpinb2 C A 1: 107,524,692 F333L probably damaging Het
Slc9a2 A C 1: 40,726,379 I310L probably damaging Het
Strip2 T A 6: 29,920,533 probably null Het
Thoc3 T C 13: 54,463,752 T241A probably damaging Het
Tmem139 T A 6: 42,263,265 V2E probably damaging Het
Usp24 G T 4: 106,387,546 V1233F probably damaging Het
Vnn1 A G 10: 23,900,747 Q332R probably benign Het
Wac T A 18: 7,921,455 H530Q probably damaging Het
Wdr35 T A 12: 8,978,659 N92K probably benign Het
Zbtb18 T G 1: 177,447,254 L60R probably damaging Het
Zfp184 T A 13: 21,959,992 C623S probably damaging Het
Zfp292 A G 4: 34,806,796 Y2088H probably damaging Het
Zfp975 G T 7: 42,662,672 S172R probably benign Het
Zswim2 G A 2: 83,915,727 Q456* probably null Het
Other mutations in Shank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Shank3 APN 15 89549416 missense probably damaging 1.00
IGL01469:Shank3 APN 15 89521274 missense probably damaging 1.00
IGL01886:Shank3 APN 15 89531663 missense probably damaging 1.00
IGL01934:Shank3 APN 15 89549846 missense probably damaging 1.00
IGL01989:Shank3 APN 15 89503299 splice site probably benign
IGL02004:Shank3 APN 15 89503299 splice site probably benign
IGL02085:Shank3 APN 15 89503915 critical splice donor site probably null
IGL02195:Shank3 APN 15 89548118 missense probably damaging 1.00
IGL02354:Shank3 APN 15 89504333 missense probably damaging 1.00
IGL02361:Shank3 APN 15 89504333 missense probably damaging 1.00
IGL02541:Shank3 APN 15 89501410 missense probably damaging 1.00
R0294:Shank3 UTSW 15 89532098 missense probably damaging 1.00
R0468:Shank3 UTSW 15 89549275 missense probably benign 0.28
R0483:Shank3 UTSW 15 89543239 splice site probably benign
R0605:Shank3 UTSW 15 89524147 missense possibly damaging 0.49
R0675:Shank3 UTSW 15 89531388 missense possibly damaging 0.92
R1082:Shank3 UTSW 15 89549371 missense probably damaging 1.00
R1576:Shank3 UTSW 15 89503663 missense probably benign 0.11
R1702:Shank3 UTSW 15 89499896 missense probably damaging 0.99
R1726:Shank3 UTSW 15 89557986 missense probably damaging 1.00
R1958:Shank3 UTSW 15 89503148 missense probably damaging 0.99
R1961:Shank3 UTSW 15 89557964 missense possibly damaging 0.60
R2420:Shank3 UTSW 15 89521210 nonsense probably null
R2513:Shank3 UTSW 15 89548686 missense probably benign 0.05
R3917:Shank3 UTSW 15 89503384 missense possibly damaging 0.77
R4163:Shank3 UTSW 15 89549594 missense probably damaging 1.00
R4205:Shank3 UTSW 15 89503318 missense probably damaging 1.00
R4434:Shank3 UTSW 15 89503359 missense probably damaging 1.00
R4791:Shank3 UTSW 15 89500354 missense probably damaging 1.00
R4816:Shank3 UTSW 15 89543115 missense probably damaging 1.00
R4828:Shank3 UTSW 15 89500199 intron probably benign
R4911:Shank3 UTSW 15 89504344 missense probably damaging 1.00
R4997:Shank3 UTSW 15 89549698 missense probably damaging 1.00
R5213:Shank3 UTSW 15 89533278 missense possibly damaging 0.82
R5338:Shank3 UTSW 15 89531711 splice site probably null
R5494:Shank3 UTSW 15 89548238 missense probably damaging 0.99
R5543:Shank3 UTSW 15 89532354 missense probably damaging 1.00
R5654:Shank3 UTSW 15 89521326 missense probably benign 0.07
R5900:Shank3 UTSW 15 89503390 missense probably damaging 1.00
R5906:Shank3 UTSW 15 89548916 missense probably damaging 1.00
R6385:Shank3 UTSW 15 89521375 critical splice donor site probably null
R6432:Shank3 UTSW 15 89503413 missense possibly damaging 0.75
R6724:Shank3 UTSW 15 89532453 missense probably damaging 1.00
R6822:Shank3 UTSW 15 89531627 missense probably damaging 1.00
R6845:Shank3 UTSW 15 89548325 missense probably benign 0.00
R7390:Shank3 UTSW 15 89549312 missense probably benign 0.05
R7808:Shank3 UTSW 15 89548880 missense probably damaging 1.00
R7862:Shank3 UTSW 15 89505445 missense possibly damaging 0.73
R7945:Shank3 UTSW 15 89505445 missense possibly damaging 0.73
RF020:Shank3 UTSW 15 89500390 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TATGTCCCATTCCAGAGTGCCC -3'
(R):5'- TGCCAACCATTCTCATCAGTG -3'

Sequencing Primer
(F):5'- TTGCGGCACAGTTGGACAAC -3'
(R):5'- TCATCAGTGGTCCCCAGCTG -3'
Posted On2019-08-05