Incidental Mutation 'R7094:Mink1'
ID568486
Institutional Source Beutler Lab
Gene Symbol Mink1
Ensembl Gene ENSMUSG00000020827
Gene Namemisshapen-like kinase 1 (zebrafish)
SynonymsMap4k6, Ysk2, MINK, Misshapen/NIKs-related kinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7094 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location70562881-70614483 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 70610075 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014753] [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102556] [ENSMUST00000102558] [ENSMUST00000102559]
Predicted Effect probably benign
Transcript: ENSMUST00000014753
SMART Domains Protein: ENSMUSP00000014753
Gene: ENSMUSG00000014609

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 2.9e-65 PFAM
Pfam:Neur_chan_memb 247 475 6.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072237
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000072873
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000079244
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102556
SMART Domains Protein: ENSMUSP00000099616
Gene: ENSMUSG00000014609

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 5.4e-65 PFAM
Pfam:Neur_chan_memb 247 474 2.9e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102558
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102559
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136663
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149845
Predicted Effect probably benign
Transcript: ENSMUST00000178764
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine kinase belonging to the germinal center kinase (GCK) family. The protein is structurally similar to the kinases that are related to NIK and may belong to a distinct subfamily of NIK-related kinases within the GCK family. Studies of the mouse homolog indicate an up-regulation of expression in the course of postnatal mouse cerebral development and activation of the cJun N-terminal kinase (JNK) and the p38 pathways. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,610 I2786F probably damaging Het
Actl6a A T 3: 32,706,338 probably benign Het
Actn2 A G 13: 12,309,657 V100A probably damaging Het
Arfgef3 G T 10: 18,646,439 A613E probably damaging Het
Atf6b G A 17: 34,653,816 probably null Het
BC048403 A G 10: 121,740,193 Y73C possibly damaging Het
Bub1 T A 2: 127,821,761 E240V probably null Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C530008M17Rik C T 5: 76,859,032 P1080L unknown Het
Ccdc141 C A 2: 77,041,453 R829L possibly damaging Het
Ccdc85c GCCGCCGCCGCCAGCGCCCCCCGCCGCCGCCAGCGCC GCCGCCGCCGCCAGCGCC 12: 108,274,618 probably null Het
Cd209g T C 8: 4,136,790 F112L possibly damaging Het
Cebpe C T 14: 54,710,603 R261H probably damaging Het
Cfap100 T C 6: 90,413,454 E68G Het
Chd9 A G 8: 90,989,561 N921S unknown Het
Chil6 T C 3: 106,404,170 N98S probably damaging Het
Clip1 T C 5: 123,623,270 K734E probably benign Het
Cyp11b2 A G 15: 74,853,658 F204S possibly damaging Het
Dnah5 A G 15: 28,453,336 T4418A probably damaging Het
Dysf T C 6: 84,100,202 V649A probably benign Het
Ergic3 G A 2: 156,016,763 V270M possibly damaging Het
Eva1a C T 6: 82,092,043 T117I probably damaging Het
Fat4 G A 3: 38,889,874 G972D probably damaging Het
Gm14412 A T 2: 177,317,345 N39K probably damaging Het
Gm5565 T C 5: 146,158,274 T221A probably benign Het
Gnptab T G 10: 88,379,504 V29G possibly damaging Het
Grem2 T C 1: 174,836,989 Y98C probably damaging Het
Grik2 A T 10: 49,355,916 I506N possibly damaging Het
Has2 T A 15: 56,681,621 Y195F probably damaging Het
Lars2 T C 9: 123,459,585 L832P probably damaging Het
Lipo5 T A 19: 33,468,849 E49D probably damaging Het
Macc1 T A 12: 119,450,391 Y767* probably null Het
Map2 G T 1: 66,412,727 E259* probably null Het
Mcm9 T C 10: 53,620,157 D310G probably damaging Het
Mtrr T C 13: 68,579,684 T48A possibly damaging Het
Nrsn1 A T 13: 25,253,741 I68N possibly damaging Het
Olfr1083-ps T C 2: 86,607,328 N81S unknown Het
Olfr1243 A T 2: 89,527,558 I284K probably damaging Het
Olfr374 A T 8: 72,109,503 probably benign Het
Olfr484 G T 7: 108,124,633 T210N probably benign Het
Olfr560 A G 7: 102,753,098 M277T probably benign Het
Pcdh17 A G 14: 84,447,395 D434G probably damaging Het
Rnf213 T A 11: 119,437,604 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sez6l2 A G 7: 126,952,924 E121G probably damaging Het
Slc35e4 T C 11: 3,913,118 S24G probably benign Het
Slc39a2 G T 14: 51,893,689 probably benign Het
Slitrk5 C T 14: 111,680,836 P631S probably benign Het
Taf2 A G 15: 55,060,086 V265A probably benign Het
Tas2r106 T C 6: 131,678,579 N103S probably benign Het
Tgm1 T C 14: 55,704,843 T684A possibly damaging Het
Tgm7 C T 2: 121,099,008 G262S probably damaging Het
Tpp2 T A 1: 43,968,988 S451T probably damaging Het
Trim15 T C 17: 36,862,896 Y240C probably benign Het
Trio A T 15: 27,891,448 C465S unknown Het
Ttc22 G A 4: 106,635,907 W250* probably null Het
Upb1 C A 10: 75,438,208 F356L probably damaging Het
Vmn2r99 T A 17: 19,379,311 M419K probably benign Het
Vstm2a G A 11: 16,257,990 probably benign Het
Zfp820 T C 17: 21,819,265 T361A probably benign Het
Other mutations in Mink1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Mink1 APN 11 70603812 missense probably damaging 0.99
IGL00709:Mink1 APN 11 70613019 missense probably damaging 0.99
IGL01064:Mink1 APN 11 70603481 missense probably benign 0.05
IGL02612:Mink1 APN 11 70597226 missense probably damaging 1.00
IGL02797:Mink1 APN 11 70610350 missense probably damaging 1.00
IGL03056:Mink1 APN 11 70612583 critical splice donor site probably null
IGL03066:Mink1 APN 11 70608889 missense probably benign 0.01
IGL03185:Mink1 APN 11 70603860 missense probably damaging 1.00
PIT4498001:Mink1 UTSW 11 70598888 missense probably benign 0.05
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0025:Mink1 UTSW 11 70613042 missense probably damaging 1.00
R0488:Mink1 UTSW 11 70597204 missense probably damaging 1.00
R0637:Mink1 UTSW 11 70601676 missense probably damaging 0.96
R0828:Mink1 UTSW 11 70610145 nonsense probably null
R1081:Mink1 UTSW 11 70607035 missense probably benign 0.07
R1175:Mink1 UTSW 11 70611340 missense probably benign 0.02
R1441:Mink1 UTSW 11 70607114 missense possibly damaging 0.72
R1532:Mink1 UTSW 11 70602007 missense probably null 1.00
R1545:Mink1 UTSW 11 70598891 missense possibly damaging 0.60
R1634:Mink1 UTSW 11 70608880 missense probably benign 0.00
R1932:Mink1 UTSW 11 70608428 critical splice donor site probably null
R2033:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R2184:Mink1 UTSW 11 70603797 missense probably damaging 1.00
R2267:Mink1 UTSW 11 70601724 splice site probably null
R2268:Mink1 UTSW 11 70601724 splice site probably null
R2859:Mink1 UTSW 11 70612508 missense probably damaging 1.00
R3713:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3714:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3715:Mink1 UTSW 11 70608950 missense possibly damaging 0.93
R3716:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R3717:Mink1 UTSW 11 70607761 missense probably damaging 0.98
R4607:Mink1 UTSW 11 70606067 missense possibly damaging 0.72
R4735:Mink1 UTSW 11 70609260 splice site probably null
R4790:Mink1 UTSW 11 70599041 missense probably damaging 0.99
R4847:Mink1 UTSW 11 70602028 missense probably damaging 1.00
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R4860:Mink1 UTSW 11 70611592 missense probably damaging 0.98
R5081:Mink1 UTSW 11 70605144 missense probably damaging 0.98
R5310:Mink1 UTSW 11 70607343 missense probably benign 0.33
R5677:Mink1 UTSW 11 70605165 missense possibly damaging 0.66
R5767:Mink1 UTSW 11 70606075 missense possibly damaging 0.53
R5795:Mink1 UTSW 11 70607790 missense possibly damaging 0.86
R5888:Mink1 UTSW 11 70610059 unclassified probably benign
R5950:Mink1 UTSW 11 70609586 missense possibly damaging 0.81
R6024:Mink1 UTSW 11 70599089 missense possibly damaging 0.71
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6034:Mink1 UTSW 11 70607040 small deletion probably benign
R6058:Mink1 UTSW 11 70611720 missense possibly damaging 0.96
R6144:Mink1 UTSW 11 70610652 missense possibly damaging 0.66
R6154:Mink1 UTSW 11 70610101 missense possibly damaging 0.46
R6218:Mink1 UTSW 11 70598894 missense possibly damaging 0.94
R6262:Mink1 UTSW 11 70603325 splice site probably null
R6269:Mink1 UTSW 11 70598987 missense probably damaging 1.00
R6273:Mink1 UTSW 11 70611435 nonsense probably null
R6301:Mink1 UTSW 11 70612294 missense possibly damaging 0.71
R6603:Mink1 UTSW 11 70609593 missense probably damaging 0.96
R6876:Mink1 UTSW 11 70607435 missense probably benign 0.02
R7030:Mink1 UTSW 11 70607775 missense possibly damaging 0.46
R7050:Mink1 UTSW 11 70612332 missense possibly damaging 0.93
R7135:Mink1 UTSW 11 70603503 missense probably damaging 1.00
R7238:Mink1 UTSW 11 70611479 critical splice donor site probably null
R7320:Mink1 UTSW 11 70599073 missense probably benign 0.23
R7396:Mink1 UTSW 11 70605168 missense possibly damaging 0.73
R7446:Mink1 UTSW 11 70609629 missense probably benign 0.18
R7723:Mink1 UTSW 11 70612910 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCTCTATCAGCCTGAGACCC -3'
(R):5'- CAGGTTTGTGTAGCCATTGC -3'

Sequencing Primer
(F):5'- TATCAGCCTGAGACCCTGTCAG -3'
(R):5'- CCTCTTCAGGAGTCTAAAGTTAGAG -3'
Posted On2019-08-09