Incidental Mutation 'R7062:Smurf1'
ID568501
Institutional Source Beutler Lab
Gene Symbol Smurf1
Ensembl Gene ENSMUSG00000038780
Gene NameSMAD specific E3 ubiquitin protein ligase 1
Synonyms4930431E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7062 (G1)
Quality Score129.008
Status Validated
Chromosome5
Chromosomal Location144876495-144965847 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 144893546 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085684] [ENSMUST00000100461] [ENSMUST00000110677]
Predicted Effect probably null
Transcript: ENSMUST00000085684
SMART Domains Protein: ENSMUSP00000082827
Gene: ENSMUSG00000038780

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 281 313 8.66e-13 SMART
HECTc 392 731 3.48e-160 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100461
SMART Domains Protein: ENSMUSP00000098029
Gene: ENSMUSG00000038780

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 281 313 8.66e-13 SMART
HECTc 392 728 2.72e-162 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110677
SMART Domains Protein: ENSMUSP00000106305
Gene: ENSMUSG00000038780

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 307 339 8.66e-13 SMART
HECTc 418 757 3.48e-160 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198621
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin ligase that is specific for receptor-regulated SMAD proteins in the bone morphogenetic protein (BMP) pathway. This protein plays a key roll in the regulation of cell motility, cell signalling, and cell polarity. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for one knock-out allele display increased osteoblast function, bone density, and thickness of the cortical bone in long bones. Mice homozygous for a different knock-out allele are viable and only display gastrulation defects in combination with a Smurf2 knock-out allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T A 6: 142,599,146 D1370V probably damaging Het
Ackr1 A T 1: 173,332,115 I279N possibly damaging Het
Adcy10 A G 1: 165,538,522 H536R probably benign Het
Adgrb3 T C 1: 25,826,085 T226A possibly damaging Het
Apol10b T A 15: 77,585,273 M235L probably benign Het
Arhgap44 T C 11: 65,011,932 T570A probably benign Het
Astn1 A G 1: 158,688,511 probably null Het
Camsap3 A G 8: 3,607,834 probably benign Het
Ccdc73 C T 2: 104,951,878 A193V probably damaging Het
Ccl20 G A 1: 83,117,814 C32Y probably damaging Het
Cdk11b A G 4: 155,626,811 E16G probably damaging Het
Celsr2 T A 3: 108,402,510 N1591I possibly damaging Het
Col5a2 T C 1: 45,417,625 E306G probably benign Het
Cpa1 C T 6: 30,640,677 A106V probably benign Het
Ctdspl G A 9: 119,037,470 R199H probably damaging Het
Cyfip2 G A 11: 46,260,832 P547S probably damaging Het
Cyp2c37 A T 19: 39,995,546 probably null Het
Dnajc16 A G 4: 141,766,690 F549L probably damaging Het
Dnm3 T A 1: 162,134,491 K50* probably null Het
Eci1 C T 17: 24,426,740 probably benign Het
Eif2b4 C T 5: 31,192,831 C49Y probably benign Het
Emc3 A T 6: 113,522,796 I56N probably damaging Het
Enthd1 A G 15: 80,452,544 L563P probably damaging Het
Ercc4 T A 16: 13,132,947 I635K probably damaging Het
Espl1 A C 15: 102,298,896 N265T probably benign Het
Fads2 T C 19: 10,065,598 probably null Het
Fam186a G A 15: 99,933,640 probably benign Het
Fastkd1 A T 2: 69,704,322 I368K possibly damaging Het
Fat1 G A 8: 44,950,216 M1I probably null Het
Foxj1 T C 11: 116,331,993 E328G probably benign Het
Gfod2 T C 8: 105,722,876 probably benign Het
Gm6525 C T 3: 84,174,891 R40C probably benign Het
Gna12 G A 5: 140,785,485 T144I probably benign Het
Ighv9-3 T C 12: 114,141,092 M11V probably benign Het
Kcnj14 T C 7: 45,817,890 Y344C probably damaging Het
Lrrc63 A T 14: 75,086,297 S496T probably benign Het
Ltn1 T C 16: 87,427,603 T78A probably damaging Het
Matr3 T A 18: 35,579,019 probably null Het
Mcpt4 A G 14: 56,060,668 M142T probably benign Het
Mroh7 A G 4: 106,683,980 F1154S probably damaging Het
Mrpl1 G T 5: 96,213,791 L12F probably benign Het
Myo3b G A 2: 70,217,157 V308I probably benign Het
Nfasc A G 1: 132,601,969 probably null Het
Npc1l1 T A 11: 6,217,807 M995L probably benign Het
Nvl A G 1: 181,112,334 I617T probably benign Het
Oas1h C A 5: 120,861,465 probably benign Het
Oasl2 T A 5: 114,911,091 Y197* probably null Het
Olfr1156 T C 2: 87,950,224 E3G probably benign Het
Olfr262 T C 19: 12,240,725 N312S probably benign Het
Olfr495 C T 7: 108,395,830 R237* probably null Het
Olfr598 T C 7: 103,329,086 V200A probably benign Het
Olfr728 A G 14: 50,140,450 L63P probably damaging Het
Olfr955 A T 9: 39,470,057 I223N probably benign Het
Orc6 T C 8: 85,302,908 V27A probably damaging Het
Parp4 A T 14: 56,614,759 R799S possibly damaging Het
Pcdhga1 C A 18: 37,825,077 S826R probably damaging Het
Phldb1 T C 9: 44,696,135 R1258G probably damaging Het
Ppfia1 T C 7: 144,552,473 S21G probably benign Het
Ppp1r18 C A 17: 35,868,211 T326K probably damaging Het
Psg26 A G 7: 18,482,596 L106P probably damaging Het
Rabgap1l A T 1: 160,226,650 D265E probably benign Het
Rasgrp4 T C 7: 29,150,194 L554P possibly damaging Het
Rnf17 G T 14: 56,465,654 V621L probably benign Het
Sart3 T C 5: 113,745,602 K783R possibly damaging Het
Slc23a2 T A 2: 132,091,269 I90F probably damaging Het
Slc5a2 A T 7: 128,270,040 M331L probably damaging Het
Slc5a7 C G 17: 54,293,001 G128A probably damaging Het
Smcr8 A T 11: 60,780,354 Q776L probably damaging Het
Smpd4 T A 16: 17,640,971 D519E probably damaging Het
Spata18 T A 5: 73,659,293 N125K probably benign Het
Spice1 T A 16: 44,357,896 M94K probably damaging Het
Stard4 T C 18: 33,205,534 probably null Het
Stx17 A G 4: 48,140,442 D49G probably benign Het
Tbce T C 13: 14,019,795 D93G possibly damaging Het
Tbx21 T A 11: 97,098,893 D491V probably damaging Het
Tmbim4 G T 10: 120,208,826 probably benign Het
Tmem209 C T 6: 30,502,017 R62H probably damaging Het
Tmem237 A T 1: 59,119,612 probably null Het
Tmprss9 T C 10: 80,895,049 I803T probably benign Het
Trip4 C T 9: 65,885,010 A7T probably benign Het
Unc13a T C 8: 71,663,237 D107G probably benign Het
Uso1 C A 5: 92,192,740 Q672K possibly damaging Het
Washc2 T A 6: 116,219,988 N239K possibly damaging Het
Zfp661 A G 2: 127,577,120 C367R probably damaging Het
Znrf3 T A 11: 5,281,550 E558D probably damaging Het
Other mutations in Smurf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Smurf1 APN 5 144881774 missense probably benign 0.00
IGL01577:Smurf1 APN 5 144893188 missense probably damaging 0.99
IGL02232:Smurf1 APN 5 144886438 missense probably damaging 1.00
IGL02407:Smurf1 APN 5 144884724 missense probably damaging 1.00
IGL02959:Smurf1 APN 5 144899389 missense probably damaging 1.00
IGL02997:Smurf1 APN 5 144898005 nonsense probably null
IGL03227:Smurf1 APN 5 144899182 missense probably damaging 1.00
IGL03293:Smurf1 APN 5 144881799 missense probably benign
R1563:Smurf1 UTSW 5 144882513 missense probably damaging 1.00
R1652:Smurf1 UTSW 5 144880664 missense probably damaging 1.00
R2698:Smurf1 UTSW 5 144883562 unclassified probably benign
R3794:Smurf1 UTSW 5 144901175 critical splice donor site probably null
R4274:Smurf1 UTSW 5 144896775 intron probably benign
R4282:Smurf1 UTSW 5 144882593 missense probably damaging 1.00
R4287:Smurf1 UTSW 5 144891458 missense probably benign 0.00
R4643:Smurf1 UTSW 5 144879369 missense probably damaging 1.00
R4723:Smurf1 UTSW 5 144893184 missense probably damaging 1.00
R5496:Smurf1 UTSW 5 144882593 nonsense probably null
R5702:Smurf1 UTSW 5 144901211 missense possibly damaging 0.96
R5846:Smurf1 UTSW 5 144879380 missense probably damaging 1.00
R6107:Smurf1 UTSW 5 144894504 missense possibly damaging 0.75
R6263:Smurf1 UTSW 5 144881731 missense probably damaging 0.96
R6477:Smurf1 UTSW 5 144889792 missense possibly damaging 0.49
R6548:Smurf1 UTSW 5 144899497 missense probably damaging 1.00
R6584:Smurf1 UTSW 5 144882523 missense probably damaging 0.97
R6981:Smurf1 UTSW 5 144886369 missense possibly damaging 0.69
R7900:Smurf1 UTSW 5 144899373 missense probably damaging 1.00
R8271:Smurf1 UTSW 5 144894087 missense possibly damaging 0.53
R8361:Smurf1 UTSW 5 144883696 missense probably damaging 1.00
R8919:Smurf1 UTSW 5 144883612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACAGGGATTTCCTAGCAAGG -3'
(R):5'- CTGCCAACAGGATCACAGTTATC -3'

Sequencing Primer
(F):5'- GATTTCCTAGCAAGGTGCCCATG -3'
(R):5'- AACACTTGCTGCTGAACATGG -3'
Posted On2019-08-09