Incidental Mutation 'R7071:Cnot10'
ID568504
Institutional Source Beutler Lab
Gene Symbol Cnot10
Ensembl Gene ENSMUSG00000056167
Gene NameCCR4-NOT transcription complex, subunit 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7071 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location114585878-114640184 bp(-) (GRCm38)
Type of Mutationintron (73 bp from exon)
DNA Base Change (assembly) T to C at 114617719 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000064840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070117] [ENSMUST00000215155] [ENSMUST00000216785] [ENSMUST00000217148]
Predicted Effect probably null
Transcript: ENSMUST00000070117
SMART Domains Protein: ENSMUSP00000064840
Gene: ENSMUSG00000056167

DomainStartEndE-ValueType
Blast:TPR 27 60 2e-10 BLAST
coiled coil region 73 107 N/A INTRINSIC
TPR 110 143 4.32e1 SMART
low complexity region 182 198 N/A INTRINSIC
TPR 293 326 3.37e-2 SMART
TPR 355 388 6.75e1 SMART
low complexity region 496 508 N/A INTRINSIC
TPR 643 676 7.87e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215155
Predicted Effect probably benign
Transcript: ENSMUST00000216785
Predicted Effect probably benign
Transcript: ENSMUST00000217148
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,629,140 Q854* probably null Het
Arl2bp G T 8: 94,667,166 probably benign Het
Astl T C 2: 127,345,965 M121T probably benign Het
Atrip T C 9: 109,067,014 probably null Het
Camk1g A T 1: 193,359,809 V44E probably benign Het
Cc2d2a A G 5: 43,709,113 H804R probably benign Het
Cd300a T C 11: 114,901,273 S314P probably damaging Het
Ceacam5 A T 7: 17,750,652 I440L possibly damaging Het
Cfap61 T G 2: 146,001,912 I306R probably benign Het
Cntln T A 4: 85,100,385 L76Q probably damaging Het
Cobl A G 11: 12,254,795 C636R probably benign Het
Dnm3 A T 1: 162,019,843 H148Q probably damaging Het
Dot1l T A 10: 80,792,245 L1039Q probably benign Het
Faiml T A 9: 99,236,347 M1L unknown Het
Fat1 T G 8: 44,989,108 I1149S possibly damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm11938 A T 11: 99,603,084 C62S probably damaging Het
Gm15448 A G 7: 3,821,668 S573P unknown Het
Gtf2i A G 5: 134,263,621 L423S probably damaging Het
Hmcn1 A T 1: 150,604,102 C4582S probably damaging Het
Ifitm3 A G 7: 141,010,524 V41A probably benign Het
Ipo11 T A 13: 106,925,096 S19C probably damaging Het
Khsrp C A 17: 57,025,386 M268I possibly damaging Het
Lrp1b T G 2: 41,408,264 D1036A Het
Mecom T G 3: 29,980,708 H273P probably damaging Het
Mfn1 G A 3: 32,568,395 V601I probably benign Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Myo18a A G 11: 77,823,827 T811A probably damaging Het
Ndfip2 A C 14: 105,302,326 N292H possibly damaging Het
Olfr318 C A 11: 58,720,158 V297F possibly damaging Het
Otog T A 7: 46,267,323 C895S probably damaging Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Ptprn A T 1: 75,260,619 M113K possibly damaging Het
Rag1 T C 2: 101,643,462 H445R probably damaging Het
Ranbp2 T G 10: 58,492,837 F2853V probably damaging Het
Skint5 A T 4: 113,779,080 F647Y unknown Het
Stt3b T C 9: 115,254,017 Y449C probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Zfp451 A C 1: 33,776,744 D708E possibly damaging Het
Zfp456 T C 13: 67,372,777 E33G probably damaging Het
Zfp599 T C 9: 22,258,096 T27A probably benign Het
Other mutations in Cnot10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Cnot10 APN 9 114631855 missense probably benign 0.19
IGL02004:Cnot10 APN 9 114622930 missense probably damaging 1.00
IGL03297:Cnot10 APN 9 114598716 missense possibly damaging 0.87
R0348:Cnot10 UTSW 9 114598770 missense probably benign 0.10
R0390:Cnot10 UTSW 9 114629150 nonsense probably null
R1256:Cnot10 UTSW 9 114610681 missense probably damaging 1.00
R1471:Cnot10 UTSW 9 114591551 missense probably benign 0.00
R1607:Cnot10 UTSW 9 114629095 nonsense probably null
R1721:Cnot10 UTSW 9 114614999 missense probably benign
R1741:Cnot10 UTSW 9 114597824 missense possibly damaging 0.87
R2116:Cnot10 UTSW 9 114626436 missense probably damaging 1.00
R4073:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4074:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4075:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4365:Cnot10 UTSW 9 114631881 nonsense probably null
R4383:Cnot10 UTSW 9 114631881 nonsense probably null
R4385:Cnot10 UTSW 9 114631881 nonsense probably null
R4398:Cnot10 UTSW 9 114631881 nonsense probably null
R4423:Cnot10 UTSW 9 114617920 missense probably damaging 1.00
R4859:Cnot10 UTSW 9 114627464 missense probably damaging 1.00
R4916:Cnot10 UTSW 9 114629134 missense possibly damaging 0.72
R4927:Cnot10 UTSW 9 114617944 missense probably damaging 1.00
R5153:Cnot10 UTSW 9 114613735 missense probably damaging 1.00
R5677:Cnot10 UTSW 9 114629093 missense probably damaging 1.00
R5702:Cnot10 UTSW 9 114629010 missense probably damaging 0.98
R5790:Cnot10 UTSW 9 114625917 splice site probably null
R6190:Cnot10 UTSW 9 114632723 missense probably damaging 1.00
R6353:Cnot10 UTSW 9 114597546 missense probably damaging 1.00
R6463:Cnot10 UTSW 9 114625902 missense probably damaging 1.00
R6819:Cnot10 UTSW 9 114615055 missense probably benign 0.10
R6849:Cnot10 UTSW 9 114631936 missense probably benign 0.01
R6875:Cnot10 UTSW 9 114615107 missense probably benign 0.00
R7408:Cnot10 UTSW 9 114631826 missense probably benign 0.33
R7412:Cnot10 UTSW 9 114625903 missense probably damaging 1.00
R7645:Cnot10 UTSW 9 114613637 missense probably benign
R7706:Cnot10 UTSW 9 114593438 missense probably damaging 0.98
X0062:Cnot10 UTSW 9 114615134 intron probably null
Predicted Primers PCR Primer
(F):5'- CAGAAGACTTACATTCAGTGGCAG -3'
(R):5'- GCCTTCGAGTGTCTGATTGAAG -3'

Sequencing Primer
(F):5'- TGGAAATGAGGTCTTAGATTCCCAG -3'
(R):5'- AAGCTGTTCAGGTGTACCAC -3'
Posted On2019-08-09