Incidental Mutation 'R7018:Wdr20rt'
ID568510
Institutional Source Beutler Lab
Gene Symbol Wdr20rt
Ensembl Gene ENSMUSG00000035560
Gene NameWD repeat domain 20, retrogene
Synonyms4921538B03Rik, Wdr20b, 4930427E19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.552) question?
Stock #R7018 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location65225517-65233359 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to T at 65225762 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046331] [ENSMUST00000221658] [ENSMUST00000221980] [ENSMUST00000222822]
Predicted Effect probably benign
Transcript: ENSMUST00000046331
SMART Domains Protein: ENSMUSP00000036682
Gene: ENSMUSG00000035560

DomainStartEndE-ValueType
WD40 140 178 1.33e1 SMART
WD40 205 246 1.38e-2 SMART
WD40 249 288 1.57e-6 SMART
WD40 291 380 8.29e-1 SMART
low complexity region 465 478 N/A INTRINSIC
Blast:WD40 480 557 1e-29 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000221658
Predicted Effect probably null
Transcript: ENSMUST00000221980
Predicted Effect probably benign
Transcript: ENSMUST00000222822
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 62,937,049 R129L probably damaging Het
Arhgef28 C T 13: 97,965,435 V844I probably damaging Het
Arhgef5 T C 6: 43,288,731 V1569A probably damaging Het
Atr T A 9: 95,866,694 S431T probably benign Het
Cdh11 T C 8: 102,634,321 D795G possibly damaging Het
Crygf T C 1: 65,927,971 S85P probably benign Het
Diexf A G 1: 193,114,855 I563T probably benign Het
Dip2c T A 13: 9,659,278 Y1385N probably damaging Het
Dnah14 G A 1: 181,626,944 V840I possibly damaging Het
Dsg1a T C 18: 20,328,738 F299L possibly damaging Het
Fgfr4 A T 13: 55,166,200 S576C probably damaging Het
Frmd8 T C 19: 5,869,518 D167G probably damaging Het
Gm5105 G A 3: 138,049,558 T89I unknown Het
Grhl1 C T 12: 24,575,997 S35L possibly damaging Het
Gsn A G 2: 35,293,506 E242G probably benign Het
Hcrtr1 A G 4: 130,135,868 I140T probably damaging Het
Ifnlr1 T C 4: 135,703,824 Y208H possibly damaging Het
Ighv1-58 T C 12: 115,312,365 Y51C probably damaging Het
Iqcj T A 3: 68,041,247 Y21* probably null Het
Kcnc4 T C 3: 107,458,862 Y10C probably benign Het
Kcnk7 G T 19: 5,706,132 G129W probably damaging Het
Kcnq2 T A 2: 181,081,724 R620* probably null Het
Klk13 C A 7: 43,726,702 P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Lamc2 T A 1: 153,136,742 M729L probably benign Het
Lyst T G 13: 13,743,459 probably null Het
Med13l G A 5: 118,751,986 R1909H probably damaging Het
Mstn T A 1: 53,064,084 L193Q possibly damaging Het
Mylk T C 16: 35,000,426 V125A possibly damaging Het
Nalcn T A 14: 123,409,821 M547L probably damaging Het
Nckap5 A G 1: 126,025,048 S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 Y189C probably damaging Het
Olfr1164 T A 2: 88,093,256 I227F probably benign Het
Olfr193 A G 16: 59,110,607 M1T probably null Het
Olfr490 T G 7: 108,286,344 I261L probably benign Het
Olfr761 A T 17: 37,952,502 I174N probably damaging Het
Oosp3 T A 19: 11,699,419 D47E probably benign Het
Pcdh15 G T 10: 74,466,354 G942W probably damaging Het
Pcyox1l C A 18: 61,707,554 probably benign Het
Peg3 T C 7: 6,708,839 E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plscr1 T A 9: 92,264,662 V119D probably damaging Het
Prss56 A T 1: 87,185,948 D258V possibly damaging Het
Ptpn23 T G 9: 110,385,816 K85Q possibly damaging Het
Ranbp3l C A 15: 9,007,285 S7Y probably benign Het
Rnf31 T C 14: 55,592,233 L85P probably damaging Het
Rptn T C 3: 93,397,900 C847R possibly damaging Het
Six4 T A 12: 73,108,953 E413D probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Sned1 T C 1: 93,284,421 V1115A probably damaging Het
Spen T C 4: 141,493,444 K401E unknown Het
Srbd1 T A 17: 86,136,415 R128W possibly damaging Het
Strc A T 2: 121,369,058 I1300N probably damaging Het
Susd1 T G 4: 59,390,627 T230P probably benign Het
Thumpd2 G T 17: 81,055,897 S47* probably null Het
Tmprss11a C T 5: 86,428,570 V141I probably damaging Het
Tmprss15 T C 16: 79,024,853 Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,356,951 S56P probably damaging Het
Ttc39d T C 17: 80,216,181 W90R probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp646 C A 7: 127,882,322 Q1224K probably benign Het
Other mutations in Wdr20rt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Wdr20rt APN 12 65225970 missense possibly damaging 0.95
IGL02142:Wdr20rt APN 12 65227265 missense probably benign 0.22
IGL02938:Wdr20rt APN 12 65225918 missense probably benign 0.01
R0501:Wdr20rt UTSW 12 65225807 missense probably benign 0.02
R0548:Wdr20rt UTSW 12 65227315 missense probably benign 0.00
R0652:Wdr20rt UTSW 12 65225915 missense probably damaging 0.98
R1715:Wdr20rt UTSW 12 65227314 missense probably damaging 0.98
R1733:Wdr20rt UTSW 12 65227281 missense possibly damaging 0.87
R1851:Wdr20rt UTSW 12 65227151 missense possibly damaging 0.89
R2010:Wdr20rt UTSW 12 65227214 missense possibly damaging 0.88
R2214:Wdr20rt UTSW 12 65227413 missense probably damaging 1.00
R2254:Wdr20rt UTSW 12 65226233 missense probably damaging 1.00
R4793:Wdr20rt UTSW 12 65226621 missense probably damaging 0.99
R5169:Wdr20rt UTSW 12 65227410 missense probably damaging 0.99
R6238:Wdr20rt UTSW 12 65226190 start gained probably benign
R7143:Wdr20rt UTSW 12 65225918 missense probably benign 0.08
R7707:Wdr20rt UTSW 12 65226207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAAATGTTTCTTAAAGCCCCTAC -3'
(R):5'- AGATATAGACGTAGAGCTCCCG -3'

Sequencing Primer
(F):5'- GTTTCTTAAAGCCCCTACATTTACAG -3'
(R):5'- CGGTTGCCATTACCAGTCTGG -3'
Posted On2019-08-15