Mutagenetix > Incidental Mutations

Incidental Mutation 'R7052:Dctn1'

568527

Institutional Source

Beutler Lab

Gene Symbol

Dctn1

Ensembl Gene

ENSMUSG00000031865

Gene Name

dynactin 1

Synonyms

p150, Glued, p150

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_007835.2, NM_001198866.1, NM_001198867.1; MGI: 107745

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7052 (G1)

Quality Score

100.013

Status

Validated

Chromosome

Chromosomal Location

83165920-83200117 bp(+) (GRCm38)

Type of Mutation

intron (167 bp from exon)

DNA Base Change (assembly)

T to A at 83195280 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000109552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077407] [ENSMUST00000113907] [ENSMUST00000113913] [ENSMUST00000113918] [ENSMUST00000113919]

Predicted Effect

probably null
Transcript: ENSMUST00000077407

SMART Domains

Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865

Domain	Start	End	E-Value	Type
CAP_GLY	12	78	5.52e-31	SMART
low complexity region	124	147	N/A	INTRINSIC
low complexity region	148	177	N/A	INTRINSIC
SCOP:d1fxkc_	185	337	3e-3	SMART
low complexity region	363	379	N/A	INTRINSIC
Pfam:Dynactin	489	768	8.2e-91	PFAM
low complexity region	800	820	N/A	INTRINSIC
coiled coil region	914	1009	N/A	INTRINSIC
low complexity region	1025	1043	N/A	INTRINSIC
coiled coil region	1143	1172	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000113907

SMART Domains

Protein: ENSMUSP00000109540
Gene: ENSMUSG00000031865

Domain	Start	End	E-Value	Type
low complexity region	5	22	N/A	INTRINSIC
low complexity region	27	50	N/A	INTRINSIC
low complexity region	51	80	N/A	INTRINSIC
low complexity region	93	106	N/A	INTRINSIC
low complexity region	140	158	N/A	INTRINSIC
SCOP:d1lxa__	271	345	8e-3	SMART
Pfam:Dynactin	392	671	7.1e-91	PFAM
low complexity region	703	723	N/A	INTRINSIC
coiled coil region	817	912	N/A	INTRINSIC
low complexity region	928	946	N/A	INTRINSIC
coiled coil region	1046	1075	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000113913

SMART Domains

Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865

Domain	Start	End	E-Value	Type
CAP_GLY	12	78	5.52e-31	SMART
low complexity region	118	139	N/A	INTRINSIC
low complexity region	144	167	N/A	INTRINSIC
low complexity region	168	197	N/A	INTRINSIC
SCOP:d1fxkc_	205	357	3e-3	SMART
low complexity region	383	399	N/A	INTRINSIC
Pfam:Dynactin	509	788	2.5e-90	PFAM
low complexity region	820	840	N/A	INTRINSIC
coiled coil region	934	1029	N/A	INTRINSIC
low complexity region	1051	1069	N/A	INTRINSIC
coiled coil region	1168	1197	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000113918

SMART Domains

Protein: ENSMUSP00000109551
Gene: ENSMUSG00000031865

Domain	Start	End	E-Value	Type
CAP_GLY	29	95	5.52e-31	SMART
low complexity region	135	156	N/A	INTRINSIC
low complexity region	161	184	N/A	INTRINSIC
low complexity region	185	214	N/A	INTRINSIC
low complexity region	227	240	N/A	INTRINSIC
low complexity region	274	292	N/A	INTRINSIC
low complexity region	400	416	N/A	INTRINSIC
Pfam:Dynactin	526	805	3.3e-90	PFAM
low complexity region	837	857	N/A	INTRINSIC
coiled coil region	951	1046	N/A	INTRINSIC
coiled coil region	1147	1176	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000113919

SMART Domains

Protein: ENSMUSP00000109552
Gene: ENSMUSG00000031865

Domain	Start	End	E-Value	Type
CAP_GLY	29	95	5.52e-31	SMART
low complexity region	135	156	N/A	INTRINSIC
low complexity region	161	184	N/A	INTRINSIC
low complexity region	185	214	N/A	INTRINSIC
SCOP:d1fxkc_	222	374	3e-3	SMART
low complexity region	400	416	N/A	INTRINSIC
Pfam:Dynactin	522	805	1.4e-103	PFAM
low complexity region	837	857	N/A	INTRINSIC
coiled coil region	951	1046	N/A	INTRINSIC
low complexity region	1068	1086	N/A	INTRINSIC
coiled coil region	1185	1214	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (63/63)

MGI Phenotype

Strain: 3769512
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and developmental arrest at E7.5 associated with increased apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(20) : Targeted(4) Gene trapped(16)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	C	T	6: 142,658,535	R658H	probably benign	Het
Als2cl	C	T	9: 110,898,083	R906C	probably damaging	Het
Asb8	T	C	15: 98,136,401	H91R	probably damaging	Het
Atp8b3	C	T	10: 80,520,024	E1285K	probably benign	Het
Bves	G	A	10: 45,346,290	R172H	possibly damaging	Het
C6	A	T	15: 4,733,695	N59I	probably damaging	Het
Capn15	A	T	17: 25,961,750	V782D	probably damaging	Het
Ccdc18	T	C	5: 108,161,688	L383S	probably benign	Het
Coro6	C	A	11: 77,466,230	N119K	probably benign	Het
Cps1	T	A	1: 67,198,410	D1023E	probably damaging	Het
Ero1l	T	A	14: 45,306,583	K55*	probably null	Het
Fam209	G	A	2: 172,472,831	G80D	possibly damaging	Het
Fam71d	C	T	12: 78,719,402	T315I	probably benign	Het
Fam89b	G	A	19: 5,729,248	R94C	probably damaging	Het
Fut1	A	G	7: 45,619,757	*323W	probably null	Het
Gm47985	T	A	1: 151,183,139	F177Y	possibly damaging	Het
Gm8251	T	A	1: 44,057,306	Y1544F	possibly damaging	Het
Gstm7	T	A	3: 107,931,317	D37V	probably damaging	Het
H2-Aa	T	A	17: 34,284,510	S38C	possibly damaging	Het
Ighg2c	T	C	12: 113,288,723	T70A		Het
Ino80	A	G	2: 119,426,587		probably null	Het
Irf8	C	T	8: 120,739,842	R9W	probably damaging	Het
Kcnt2	A	G	1: 140,383,047	N197S	probably damaging	Het
Kif11	T	A	19: 37,384,592	C86*	probably null	Het
Lonp1	A	T	17: 56,626,549	F109I	probably benign	Het
Mlkl	G	A	8: 111,319,442	S312L	possibly damaging	Het
Mroh9	T	A	1: 163,038,956	Q706L	possibly damaging	Het
Mtmr7	T	C	8: 40,555,833	H315R	possibly damaging	Het
Myh7b	G	C	2: 155,614,133	R146P	probably damaging	Het
Naip5	A	G	13: 100,222,347	Y794H	probably benign	Het
Nup153	A	T	13: 46,687,473	N886K	probably benign	Het
Nup205	A	G	6: 35,215,142	R1047G	possibly damaging	Het
Olfr1487	T	A	19: 13,619,626	S155T	probably benign	Het
Olfr768	T	C	10: 129,093,875	Y33C	probably damaging	Het
Oog3	A	T	4: 144,160,457	L31Q	probably damaging	Het
Palmd	T	C	3: 116,923,363	N495S	probably benign	Het
Patj	A	G	4: 98,677,260	Q1070R	probably benign	Het
Pax1	G	A	2: 147,365,904	R232H	probably damaging	Het
Pcdhb1	A	G	18: 37,266,529	N511S	probably damaging	Het
Pigs	C	T	11: 78,341,385	L448F	probably damaging	Het
Pih1d2	A	G	9: 50,621,777	Y235C	probably damaging	Het
Pkd2l2	T	A	18: 34,425,159	I297K	possibly damaging	Het
Pou2f1	C	T	1: 165,915,115	V82I	possibly damaging	Het
Pramel1	T	C	4: 143,396,504	L17P	probably damaging	Het
Riok1	C	T	13: 38,037,015		probably benign	Het
Scg3	C	A	9: 75,661,382	E358*	probably null	Het
Siglec15	T	C	18: 78,048,731	E85G	probably damaging	Het
Snx20	T	C	8: 88,629,978	H70R	probably benign	Het
Spi1	T	A	2: 91,113,340	S76R	probably damaging	Het
Stat5a	T	C	11: 100,879,285	S463P	probably damaging	Het
Svs2	A	G	2: 164,238,206	I13T	unknown	Het
Tmem132e	T	C	11: 82,437,363	S406P	probably damaging	Het
Top1mt	T	C	15: 75,668,711	N237S	possibly damaging	Het
Trav6d-4	G	A	14: 52,753,596	V30M	possibly damaging	Het
Trp73	A	T	4: 154,064,683	M217K	probably damaging	Het
Vmn1r58	A	G	7: 5,411,135	I32T	probably benign	Het
Vmn1r9	T	C	6: 57,071,411	M157T	probably benign	Het
Vmn2r100	C	T	17: 19,531,294	S533F	possibly damaging	Het
Vmn2r112	T	A	17: 22,602,526	M160K	probably benign	Het
Vps13d	C	A	4: 145,163,344	A597S	probably benign	Het
Zfp27	AATCCGCTTGTGCA	AA	7: 29,895,021		probably benign	Het

Other mutations in Dctn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Dctn1	APN	6	83179897	missense	probably benign	0.00
IGL01450:Dctn1	APN	6	83194110	unclassified	probably benign
IGL01876:Dctn1	APN	6	83197921	missense	probably damaging	1.00
IGL01958:Dctn1	APN	6	83191344	missense	possibly damaging	0.95
IGL02554:Dctn1	APN	6	83182722	missense	probably damaging	1.00
IGL02668:Dctn1	APN	6	83191048	missense	possibly damaging	0.89
IGL02814:Dctn1	APN	6	83189914	missense	probably damaging	1.00
IGL02818:Dctn1	APN	6	83192514	missense	possibly damaging	0.86
IGL03007:Dctn1	APN	6	83182708	missense	probably damaging	1.00
IGL03065:Dctn1	APN	6	83192493	missense	probably damaging	0.99
IGL03083:Dctn1	APN	6	83197484	splice site	probably benign
IGL03394:Dctn1	APN	6	83191284	missense	possibly damaging	0.61
E0374:Dctn1	UTSW	6	83194174	missense	possibly damaging	0.93
IGL03014:Dctn1	UTSW	6	83197369	intron	probably benign
PIT4812001:Dctn1	UTSW	6	83199762	missense	possibly damaging	0.86
R0044:Dctn1	UTSW	6	83191134	missense	probably damaging	1.00
R0047:Dctn1	UTSW	6	83182632	nonsense	probably null
R0047:Dctn1	UTSW	6	83182632	nonsense	probably null
R0057:Dctn1	UTSW	6	83179892	missense	probably benign	0.14
R0731:Dctn1	UTSW	6	83183089	missense	probably damaging	0.98
R0738:Dctn1	UTSW	6	83190107	critical splice donor site	probably null
R0755:Dctn1	UTSW	6	83189077	missense	probably damaging	0.96
R0839:Dctn1	UTSW	6	83190477	missense	possibly damaging	0.53
R1035:Dctn1	UTSW	6	83190220	missense	probably damaging	1.00
R1454:Dctn1	UTSW	6	83197508	missense	possibly damaging	0.93
R1469:Dctn1	UTSW	6	83192889	missense	probably damaging	1.00
R1469:Dctn1	UTSW	6	83192889	missense	probably damaging	1.00
R1627:Dctn1	UTSW	6	83195082	missense	probably damaging	0.99
R1631:Dctn1	UTSW	6	83197596	missense	possibly damaging	0.56
R1812:Dctn1	UTSW	6	83192518	missense	possibly damaging	0.85
R1928:Dctn1	UTSW	6	83199184	splice site	probably benign
R2008:Dctn1	UTSW	6	83189956	missense	probably damaging	0.99
R2242:Dctn1	UTSW	6	83199705	missense	probably damaging	0.99
R2259:Dctn1	UTSW	6	83197586	missense	possibly damaging	0.46
R2422:Dctn1	UTSW	6	83199800	missense	possibly damaging	0.92
R2483:Dctn1	UTSW	6	83194187	missense	probably damaging	1.00
R4455:Dctn1	UTSW	6	83195049	missense	probably damaging	1.00
R4724:Dctn1	UTSW	6	83189938	missense	possibly damaging	0.53
R4812:Dctn1	UTSW	6	83189937	missense	probably benign	0.24
R4819:Dctn1	UTSW	6	83190519	missense	probably damaging	0.97
R4831:Dctn1	UTSW	6	83199771	missense	possibly damaging	0.46
R4928:Dctn1	UTSW	6	83189207	missense	possibly damaging	0.73
R5087:Dctn1	UTSW	6	83191639	missense	probably damaging	1.00
R5354:Dctn1	UTSW	6	83183126	missense	possibly damaging	0.93
R5372:Dctn1	UTSW	6	83190210	missense	probably damaging	0.96
R5493:Dctn1	UTSW	6	83182564	missense	possibly damaging	0.89
R5494:Dctn1	UTSW	6	83182564	missense	possibly damaging	0.89
R5732:Dctn1	UTSW	6	83197949	critical splice donor site	probably null
R5856:Dctn1	UTSW	6	83197865	missense	probably damaging	1.00
R6025:Dctn1	UTSW	6	83193691	intron	probably null
R6999:Dctn1	UTSW	6	83191281	missense	possibly damaging	0.89
R7133:Dctn1	UTSW	6	83180044	intron	probably null
R7485:Dctn1	UTSW	6	83189905	missense	possibly damaging	0.85
R7607:Dctn1	UTSW	6	83195069	nonsense	probably null
R7729:Dctn1	UTSW	6	83183060	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCACTCAAGATTAAGGTGTGG -3'
(R):5'- ACTTCAGTTCCTGAACGTCAC -3'

Sequencing Primer
(F):5'- TCACTCAAGATTAAGGTGTGGAGGAC -3'
(R):5'- GTCACCGTCATCCCCAGAG -3'

Posted On

2019-08-16