Incidental Mutation 'R7052:Dctn1'
ID568527
Institutional Source Beutler Lab
Gene Symbol Dctn1
Ensembl Gene ENSMUSG00000031865
Gene Namedynactin 1
Synonymsp150, Glued, p150
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_007835.2, NM_001198866.1, NM_001198867.1; MGI: 107745

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7052 (G1)
Quality Score100.013
Status Validated
Chromosome6
Chromosomal Location83165920-83200117 bp(+) (GRCm38)
Type of Mutationintron (167 bp from exon)
DNA Base Change (assembly) T to A at 83195280 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077407] [ENSMUST00000113907] [ENSMUST00000113913] [ENSMUST00000113918] [ENSMUST00000113919]
Predicted Effect probably null
Transcript: ENSMUST00000077407
SMART Domains Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
SCOP:d1fxkc_ 185 337 3e-3 SMART
low complexity region 363 379 N/A INTRINSIC
Pfam:Dynactin 489 768 8.2e-91 PFAM
low complexity region 800 820 N/A INTRINSIC
coiled coil region 914 1009 N/A INTRINSIC
low complexity region 1025 1043 N/A INTRINSIC
coiled coil region 1143 1172 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113907
SMART Domains Protein: ENSMUSP00000109540
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
low complexity region 27 50 N/A INTRINSIC
low complexity region 51 80 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
SCOP:d1lxa__ 271 345 8e-3 SMART
Pfam:Dynactin 392 671 7.1e-91 PFAM
low complexity region 703 723 N/A INTRINSIC
coiled coil region 817 912 N/A INTRINSIC
low complexity region 928 946 N/A INTRINSIC
coiled coil region 1046 1075 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113913
SMART Domains Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 168 197 N/A INTRINSIC
SCOP:d1fxkc_ 205 357 3e-3 SMART
low complexity region 383 399 N/A INTRINSIC
Pfam:Dynactin 509 788 2.5e-90 PFAM
low complexity region 820 840 N/A INTRINSIC
coiled coil region 934 1029 N/A INTRINSIC
low complexity region 1051 1069 N/A INTRINSIC
coiled coil region 1168 1197 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113918
SMART Domains Protein: ENSMUSP00000109551
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 526 805 3.3e-90 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
coiled coil region 1147 1176 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113919
SMART Domains Protein: ENSMUSP00000109552
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 29 95 5.52e-31 SMART
low complexity region 135 156 N/A INTRINSIC
low complexity region 161 184 N/A INTRINSIC
low complexity region 185 214 N/A INTRINSIC
SCOP:d1fxkc_ 222 374 3e-3 SMART
low complexity region 400 416 N/A INTRINSIC
Pfam:Dynactin 522 805 1.4e-103 PFAM
low complexity region 837 857 N/A INTRINSIC
coiled coil region 951 1046 N/A INTRINSIC
low complexity region 1068 1086 N/A INTRINSIC
coiled coil region 1185 1214 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (63/63)
MGI Phenotype Strain: 3769512
Lethality: E8-E10
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. Dynactin is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, chromosome movement, nuclear positioning, and axonogenesis. This subunit interacts with dynein intermediate chain by its domains directly binding to dynein and binds to microtubules via a highly conserved glycine-rich cytoskeleton-associated protein (CAP-Gly) domain in its N-terminus. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause distal hereditary motor neuronopathy type VIIB (HMN7B) which is also known as distal spinal and bulbar muscular atrophy (dSBMA). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and developmental arrest at E7.5 associated with increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted(4) Gene trapped(16)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,658,535 R658H probably benign Het
Als2cl C T 9: 110,898,083 R906C probably damaging Het
Asb8 T C 15: 98,136,401 H91R probably damaging Het
Atp8b3 C T 10: 80,520,024 E1285K probably benign Het
Bves G A 10: 45,346,290 R172H possibly damaging Het
C6 A T 15: 4,733,695 N59I probably damaging Het
Capn15 A T 17: 25,961,750 V782D probably damaging Het
Ccdc18 T C 5: 108,161,688 L383S probably benign Het
Coro6 C A 11: 77,466,230 N119K probably benign Het
Cps1 T A 1: 67,198,410 D1023E probably damaging Het
Ero1l T A 14: 45,306,583 K55* probably null Het
Fam209 G A 2: 172,472,831 G80D possibly damaging Het
Fam71d C T 12: 78,719,402 T315I probably benign Het
Fam89b G A 19: 5,729,248 R94C probably damaging Het
Fut1 A G 7: 45,619,757 *323W probably null Het
Gm47985 T A 1: 151,183,139 F177Y possibly damaging Het
Gm8251 T A 1: 44,057,306 Y1544F possibly damaging Het
Gstm7 T A 3: 107,931,317 D37V probably damaging Het
H2-Aa T A 17: 34,284,510 S38C possibly damaging Het
Ighg2c T C 12: 113,288,723 T70A Het
Ino80 A G 2: 119,426,587 probably null Het
Irf8 C T 8: 120,739,842 R9W probably damaging Het
Kcnt2 A G 1: 140,383,047 N197S probably damaging Het
Kif11 T A 19: 37,384,592 C86* probably null Het
Lonp1 A T 17: 56,626,549 F109I probably benign Het
Mlkl G A 8: 111,319,442 S312L possibly damaging Het
Mroh9 T A 1: 163,038,956 Q706L possibly damaging Het
Mtmr7 T C 8: 40,555,833 H315R possibly damaging Het
Myh7b G C 2: 155,614,133 R146P probably damaging Het
Naip5 A G 13: 100,222,347 Y794H probably benign Het
Nup153 A T 13: 46,687,473 N886K probably benign Het
Nup205 A G 6: 35,215,142 R1047G possibly damaging Het
Olfr1487 T A 19: 13,619,626 S155T probably benign Het
Olfr768 T C 10: 129,093,875 Y33C probably damaging Het
Oog3 A T 4: 144,160,457 L31Q probably damaging Het
Palmd T C 3: 116,923,363 N495S probably benign Het
Patj A G 4: 98,677,260 Q1070R probably benign Het
Pax1 G A 2: 147,365,904 R232H probably damaging Het
Pcdhb1 A G 18: 37,266,529 N511S probably damaging Het
Pigs C T 11: 78,341,385 L448F probably damaging Het
Pih1d2 A G 9: 50,621,777 Y235C probably damaging Het
Pkd2l2 T A 18: 34,425,159 I297K possibly damaging Het
Pou2f1 C T 1: 165,915,115 V82I possibly damaging Het
Pramel1 T C 4: 143,396,504 L17P probably damaging Het
Riok1 C T 13: 38,037,015 probably benign Het
Scg3 C A 9: 75,661,382 E358* probably null Het
Siglec15 T C 18: 78,048,731 E85G probably damaging Het
Snx20 T C 8: 88,629,978 H70R probably benign Het
Spi1 T A 2: 91,113,340 S76R probably damaging Het
Stat5a T C 11: 100,879,285 S463P probably damaging Het
Svs2 A G 2: 164,238,206 I13T unknown Het
Tmem132e T C 11: 82,437,363 S406P probably damaging Het
Top1mt T C 15: 75,668,711 N237S possibly damaging Het
Trav6d-4 G A 14: 52,753,596 V30M possibly damaging Het
Trp73 A T 4: 154,064,683 M217K probably damaging Het
Vmn1r58 A G 7: 5,411,135 I32T probably benign Het
Vmn1r9 T C 6: 57,071,411 M157T probably benign Het
Vmn2r100 C T 17: 19,531,294 S533F possibly damaging Het
Vmn2r112 T A 17: 22,602,526 M160K probably benign Het
Vps13d C A 4: 145,163,344 A597S probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Dctn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Dctn1 APN 6 83179897 missense probably benign 0.00
IGL01450:Dctn1 APN 6 83194110 unclassified probably benign
IGL01876:Dctn1 APN 6 83197921 missense probably damaging 1.00
IGL01958:Dctn1 APN 6 83191344 missense possibly damaging 0.95
IGL02554:Dctn1 APN 6 83182722 missense probably damaging 1.00
IGL02668:Dctn1 APN 6 83191048 missense possibly damaging 0.89
IGL02814:Dctn1 APN 6 83189914 missense probably damaging 1.00
IGL02818:Dctn1 APN 6 83192514 missense possibly damaging 0.86
IGL03007:Dctn1 APN 6 83182708 missense probably damaging 1.00
IGL03065:Dctn1 APN 6 83192493 missense probably damaging 0.99
IGL03083:Dctn1 APN 6 83197484 splice site probably benign
IGL03394:Dctn1 APN 6 83191284 missense possibly damaging 0.61
E0374:Dctn1 UTSW 6 83194174 missense possibly damaging 0.93
IGL03014:Dctn1 UTSW 6 83197369 intron probably benign
PIT4812001:Dctn1 UTSW 6 83199762 missense possibly damaging 0.86
R0044:Dctn1 UTSW 6 83191134 missense probably damaging 1.00
R0047:Dctn1 UTSW 6 83182632 nonsense probably null
R0047:Dctn1 UTSW 6 83182632 nonsense probably null
R0057:Dctn1 UTSW 6 83179892 missense probably benign 0.14
R0731:Dctn1 UTSW 6 83183089 missense probably damaging 0.98
R0738:Dctn1 UTSW 6 83190107 critical splice donor site probably null
R0755:Dctn1 UTSW 6 83189077 missense probably damaging 0.96
R0839:Dctn1 UTSW 6 83190477 missense possibly damaging 0.53
R1035:Dctn1 UTSW 6 83190220 missense probably damaging 1.00
R1454:Dctn1 UTSW 6 83197508 missense possibly damaging 0.93
R1469:Dctn1 UTSW 6 83192889 missense probably damaging 1.00
R1469:Dctn1 UTSW 6 83192889 missense probably damaging 1.00
R1627:Dctn1 UTSW 6 83195082 missense probably damaging 0.99
R1631:Dctn1 UTSW 6 83197596 missense possibly damaging 0.56
R1812:Dctn1 UTSW 6 83192518 missense possibly damaging 0.85
R1928:Dctn1 UTSW 6 83199184 splice site probably benign
R2008:Dctn1 UTSW 6 83189956 missense probably damaging 0.99
R2242:Dctn1 UTSW 6 83199705 missense probably damaging 0.99
R2259:Dctn1 UTSW 6 83197586 missense possibly damaging 0.46
R2422:Dctn1 UTSW 6 83199800 missense possibly damaging 0.92
R2483:Dctn1 UTSW 6 83194187 missense probably damaging 1.00
R4455:Dctn1 UTSW 6 83195049 missense probably damaging 1.00
R4724:Dctn1 UTSW 6 83189938 missense possibly damaging 0.53
R4812:Dctn1 UTSW 6 83189937 missense probably benign 0.24
R4819:Dctn1 UTSW 6 83190519 missense probably damaging 0.97
R4831:Dctn1 UTSW 6 83199771 missense possibly damaging 0.46
R4928:Dctn1 UTSW 6 83189207 missense possibly damaging 0.73
R5087:Dctn1 UTSW 6 83191639 missense probably damaging 1.00
R5354:Dctn1 UTSW 6 83183126 missense possibly damaging 0.93
R5372:Dctn1 UTSW 6 83190210 missense probably damaging 0.96
R5493:Dctn1 UTSW 6 83182564 missense possibly damaging 0.89
R5494:Dctn1 UTSW 6 83182564 missense possibly damaging 0.89
R5732:Dctn1 UTSW 6 83197949 critical splice donor site probably null
R5856:Dctn1 UTSW 6 83197865 missense probably damaging 1.00
R6025:Dctn1 UTSW 6 83193691 intron probably null
R6999:Dctn1 UTSW 6 83191281 missense possibly damaging 0.89
R7133:Dctn1 UTSW 6 83180044 intron probably null
R7485:Dctn1 UTSW 6 83189905 missense possibly damaging 0.85
R7607:Dctn1 UTSW 6 83195069 nonsense probably null
R7729:Dctn1 UTSW 6 83183060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCACTCAAGATTAAGGTGTGG -3'
(R):5'- ACTTCAGTTCCTGAACGTCAC -3'

Sequencing Primer
(F):5'- TCACTCAAGATTAAGGTGTGGAGGAC -3'
(R):5'- GTCACCGTCATCCCCAGAG -3'
Posted On2019-08-16