Incidental Mutation 'R0638:Zfp280c'
Institutional Source Beutler Lab
Gene Symbol Zfp280c
Ensembl Gene ENSMUSG00000036916
Gene Namezinc finger protein 280C
SynonymsZfp633, Suhw3
MMRRC Submission 038827-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0638 (G1)
Quality Score213
Status Validated
Chromosomal Location48541625-48594504 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 48548703 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072292] [ENSMUST00000076635] [ENSMUST00000088898] [ENSMUST00000114940]
Predicted Effect probably benign
Transcript: ENSMUST00000072292
SMART Domains Protein: ENSMUSP00000072138
Gene: ENSMUSG00000036916

low complexity region 17 36 N/A INTRINSIC
Pfam:DUF4195 47 225 2.8e-85 PFAM
ZnF_C2H2 234 254 1.61e2 SMART
ZnF_C2H2 314 336 4.45e0 SMART
ZnF_C2H2 351 374 6.75e0 SMART
ZnF_C2H2 381 404 2.36e-2 SMART
ZnF_C2H2 411 434 1.41e0 SMART
ZnF_C2H2 440 462 1.08e1 SMART
ZnF_C2H2 468 490 5.34e-1 SMART
low complexity region 511 569 N/A INTRINSIC
ZnF_C2H2 616 635 1.93e2 SMART
ZnF_C2H2 636 658 8.67e-1 SMART
ZnF_C2H2 681 708 1.93e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076635
SMART Domains Protein: ENSMUSP00000075933
Gene: ENSMUSG00000036916

low complexity region 26 45 N/A INTRINSIC
Pfam:DUF4195 56 234 2.9e-85 PFAM
ZnF_C2H2 243 263 1.61e2 SMART
ZnF_C2H2 323 345 4.45e0 SMART
ZnF_C2H2 360 383 6.75e0 SMART
ZnF_C2H2 390 413 2.36e-2 SMART
ZnF_C2H2 420 443 1.41e0 SMART
ZnF_C2H2 449 471 1.08e1 SMART
ZnF_C2H2 477 499 5.34e-1 SMART
low complexity region 520 578 N/A INTRINSIC
ZnF_C2H2 625 644 1.93e2 SMART
ZnF_C2H2 645 667 8.67e-1 SMART
ZnF_C2H2 690 717 1.93e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088898
SMART Domains Protein: ENSMUSP00000086288
Gene: ENSMUSG00000036916

low complexity region 26 45 N/A INTRINSIC
Pfam:DUF4195 56 232 4e-61 PFAM
ZnF_C2H2 243 263 1.61e2 SMART
ZnF_C2H2 323 345 4.45e0 SMART
ZnF_C2H2 360 383 6.75e0 SMART
ZnF_C2H2 390 413 2.36e-2 SMART
ZnF_C2H2 420 443 1.41e0 SMART
ZnF_C2H2 449 471 1.08e1 SMART
ZnF_C2H2 477 499 5.34e-1 SMART
low complexity region 520 578 N/A INTRINSIC
ZnF_C2H2 625 644 1.93e2 SMART
ZnF_C2H2 645 667 8.67e-1 SMART
ZnF_C2H2 690 717 1.93e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114940
SMART Domains Protein: ENSMUSP00000110590
Gene: ENSMUSG00000036916

low complexity region 26 45 N/A INTRINSIC
Pfam:DUF4195 56 234 2.5e-85 PFAM
ZnF_C2H2 243 263 1.61e2 SMART
ZnF_C2H2 323 345 4.45e0 SMART
ZnF_C2H2 360 383 6.75e0 SMART
ZnF_C2H2 390 413 2.36e-2 SMART
ZnF_C2H2 420 443 1.41e0 SMART
ZnF_C2H2 449 471 1.08e1 SMART
ZnF_C2H2 477 499 5.34e-1 SMART
low complexity region 520 578 N/A INTRINSIC
ZnF_C2H2 625 644 1.93e2 SMART
ZnF_C2H2 645 667 8.67e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143028
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc finger domain-containing protein family. This family member contains multiple Cys2-His2(C2H2)-type zinc finger domains, the most common type of zinc finger domain that self-folds to form a beta-beta-alpha structure that binds a zinc ion. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
4932414N04Rik C A 2: 68,717,228 Q161K probably benign Het
Aatk A T 11: 120,009,922 L1216Q probably damaging Het
Aifm3 T C 16: 17,503,671 F463L possibly damaging Het
Antxr2 C T 5: 97,960,637 W338* probably null Het
Apc2 T C 10: 80,304,967 S219P probably damaging Het
Arfgap3 A T 15: 83,308,188 probably null Het
Arrdc5 A G 17: 56,300,020 V75A possibly damaging Het
Atg16l2 A T 7: 101,300,110 probably null Het
Cacna1i A G 15: 80,381,080 N1511S possibly damaging Het
Cad T C 5: 31,077,688 Y2095H probably damaging Het
Chia1 T C 3: 106,128,437 probably benign Het
Crybg2 A G 4: 134,074,454 D975G probably damaging Het
Dagla T C 19: 10,254,883 I480V probably damaging Het
Efl1 C T 7: 82,651,887 T33I probably damaging Het
Esp36 A G 17: 38,417,169 F74L probably benign Het
Faim T C 9: 98,992,096 probably benign Het
Fam83h G T 15: 76,003,927 H520Q probably benign Het
Fbn2 A T 18: 58,045,374 C1931S probably damaging Het
Frs3 A G 17: 47,701,656 D96G probably benign Het
Gbp4 A G 5: 105,121,840 M374T probably damaging Het
Gimap1 C T 6: 48,741,425 probably benign Het
Gm10010 A G 6: 128,200,613 noncoding transcript Het
Gm10355 T C 3: 101,306,898 noncoding transcript Het
Gmip C T 8: 69,811,445 probably benign Het
Gpc2 A T 5: 138,278,534 F110Y possibly damaging Het
Ifi44l C T 3: 151,762,759 V45M probably benign Het
Il15 T C 8: 82,343,261 E58G probably damaging Het
Kat2b T C 17: 53,644,743 probably benign Het
Kcnh7 C A 2: 62,777,510 V576L probably benign Het
Lrrc66 T A 5: 73,615,473 probably benign Het
Mical1 A G 10: 41,482,239 E416G probably benign Het
Mroh3 A G 1: 136,191,002 Y526H probably damaging Het
Mtx2 T C 2: 74,869,290 probably benign Het
Naip6 A T 13: 100,300,528 Y496N probably benign Het
Nfyc A G 4: 120,768,884 S73P probably benign Het
Olfr1418 C T 19: 11,855,123 V277M probably damaging Het
Olfr1418 A C 19: 11,855,368 V195G probably damaging Het
Olfr382 T A 11: 73,516,924 I92F probably damaging Het
Olfr810 T A 10: 129,791,232 D119V probably damaging Het
Olfr995 A G 2: 85,438,501 I219T probably benign Het
P2ry14 A G 3: 59,115,448 V206A probably benign Het
Polg G A 7: 79,460,148 probably benign Het
Ptgs1 G A 2: 36,240,856 probably benign Het
Pus7l A G 15: 94,523,417 S671P probably benign Het
Ralgapa2 T C 2: 146,342,192 T1547A probably benign Het
Rif1 T C 2: 52,111,588 S1685P probably benign Het
Rnf213 T C 11: 119,470,210 Y4452H probably damaging Het
Samd7 A G 3: 30,756,521 D229G probably benign Het
Serpina3j T C 12: 104,314,819 S84P possibly damaging Het
Slc35d1 A G 4: 103,213,244 probably benign Het
Sorbs2 A G 8: 45,796,310 D847G probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Steap4 T C 5: 7,977,030 probably benign Het
Tg A C 15: 66,717,208 T13P probably damaging Het
Timeless T A 10: 128,244,673 Y474* probably null Het
Tmem94 T C 11: 115,792,060 probably null Het
Trdmt1 G A 2: 13,516,648 probably benign Het
Trim23 T C 13: 104,201,309 Y522H probably benign Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Txnl1 A G 18: 63,692,064 probably benign Het
Unkl T C 17: 25,208,083 probably benign Het
Usp54 T A 14: 20,589,369 probably benign Het
Vcam1 T C 3: 116,117,259 K497E possibly damaging Het
Vmn1r49 C A 6: 90,072,666 S118I possibly damaging Het
Vmn2r118 T C 17: 55,608,466 K495E probably benign Het
Wrnip1 G A 13: 32,821,090 C560Y possibly damaging Het
Xkr5 T C 8: 18,933,547 R660G probably benign Het
Zfp707 G A 15: 75,975,129 A291T possibly damaging Het
Other mutations in Zfp280c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1413:Zfp280c UTSW X 48563838 missense probably benign 0.20
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tcttgacctttctgcctcttac -3'
Posted On2013-07-11