Incidental Mutation 'R7059:Mapk9'
ID568532
Institutional Source Beutler Lab
Gene Symbol Mapk9
Ensembl Gene ENSMUSG00000020366
Gene Namemitogen-activated protein kinase 9
SynonymsJNK2, JNK/SAPK alpha, Prkm9
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R7059 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location49846751-49886421 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 49867047 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020634] [ENSMUST00000043321] [ENSMUST00000102778] [ENSMUST00000109178] [ENSMUST00000109179] [ENSMUST00000164643] [ENSMUST00000178543]
Predicted Effect probably null
Transcript: ENSMUST00000020634
SMART Domains Protein: ENSMUSP00000020634
Gene: ENSMUSG00000020366

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000043321
SMART Domains Protein: ENSMUSP00000042744
Gene: ENSMUSG00000020366

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102778
SMART Domains Protein: ENSMUSP00000099839
Gene: ENSMUSG00000020366

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109178
SMART Domains Protein: ENSMUSP00000104807
Gene: ENSMUSG00000020366

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109179
SMART Domains Protein: ENSMUSP00000104808
Gene: ENSMUSG00000020366

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164643
SMART Domains Protein: ENSMUSP00000132864
Gene: ENSMUSG00000020366

DomainStartEndE-ValueType
S_TKc 26 321 4.01e-87 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178543
SMART Domains Protein: ENSMUSP00000136977
Gene: ENSMUSG00000020366

DomainStartEndE-ValueType
S_TKc 26 321 7.6e-88 SMART
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase targets specific transcription factors, and thus mediates immediate-early gene expression in response to various cell stimuli. It is most closely related to MAPK8, both of which are involved in UV radiation induced apoptosis, thought to be related to the cytochrome c-mediated cell death pathway. This gene and MAPK8 are also known as c-Jun N-terminal kinases. This kinase blocks the ubiquitination of tumor suppressor p53, and thus it increases the stability of p53 in nonstressed cells. Studies of this gene's mouse counterpart suggest a key role in T-cell differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygotes for a null allele show resistance to TNF-induced liver injury, impaired TH1 cell differentiation, and enhanced epidermal differentiation and proliferation. Homozygotes for a reporter allele show impaired T-cell activation and apoptosis, resistance to I-R cardiac injury, and reduced LTP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik T C 2: 32,574,497 probably benign Het
9930021J03Rik T A 19: 29,719,545 E849D probably benign Het
Abca16 A G 7: 120,421,748 T5A probably benign Het
Abraxas1 T C 5: 100,806,237 D349G probably benign Het
Adcyap1r1 T A 6: 55,491,310 L405Q probably damaging Het
Aqp5 A T 15: 99,594,246 T125S probably benign Het
Asah1 A T 8: 41,347,069 N169K probably damaging Het
Atl3 A G 19: 7,533,968 N515D probably benign Het
Atl3 A C 19: 7,533,969 N520T probably benign Het
Atp6v1c2 C A 12: 17,289,004 E249* probably null Het
Bcl2a1b T A 9: 89,199,760 I134K probably damaging Het
Btbd10 C T 7: 113,329,922 R159H probably damaging Het
Chmp6 T C 11: 119,916,040 F7L probably damaging Het
Colq C A 14: 31,526,034 C409F probably damaging Het
Cpox T A 16: 58,670,927 V167E probably damaging Het
Cul3 T C 1: 80,276,424 Y545C probably benign Het
Dqx1 C T 6: 83,064,809 A544V probably benign Het
Dzip3 A G 16: 48,980,942 I73T probably benign Het
Epha3 T A 16: 63,568,455 Y810F probably damaging Het
Esp36 A T 17: 38,417,051 I113N unknown Het
Fbxw17 T A 13: 50,432,548 W429R probably damaging Het
Fcrls A T 3: 87,257,340 I293N possibly damaging Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Gm8126 T A 14: 43,261,518 L148H probably benign Het
Gpr39 C A 1: 125,677,959 S208Y probably damaging Het
Heatr5a T C 12: 51,888,234 E1662G probably damaging Het
Hgfac T A 5: 35,044,429 L302Q possibly damaging Het
Itih1 G A 14: 30,931,309 H721Y possibly damaging Het
Kat8 A G 7: 127,924,903 I372V probably benign Het
Kcnk1 T A 8: 126,029,727 Y329* probably null Het
Kcns2 A T 15: 34,838,835 I115F probably damaging Het
Kif1a C T 1: 93,046,829 probably benign Het
Lcn2 T A 2: 32,387,596 D127V possibly damaging Het
Lrfn1 T C 7: 28,466,930 V583A possibly damaging Het
Map3k1 T C 13: 111,772,778 I55V probably benign Het
Mrpl18 A G 17: 12,913,781 S154P possibly damaging Het
Mst1 C A 9: 108,084,064 H524Q probably benign Het
Mtpap T C 18: 4,396,202 L498P probably damaging Het
Myl3 C T 9: 110,742,037 probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Mzf1 G T 7: 13,053,058 S28R probably damaging Het
Olfm1 T C 2: 28,222,616 S205P probably damaging Het
Olfr671 A T 7: 104,976,017 probably null Het
Prrc2a G A 17: 35,157,388 P809S probably damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rbm48 A T 5: 3,590,625 C251* probably null Het
Rxfp1 A T 3: 79,652,269 V415E probably damaging Het
Slc12a6 T A 2: 112,352,912 L748Q probably damaging Het
Slc19a3 T A 1: 83,022,369 Y309F probably damaging Het
Slc36a1 A G 11: 55,223,672 D192G probably damaging Het
Slc38a4 G T 15: 97,009,014 S281* probably null Het
Syne1 A T 10: 5,346,859 S1201T probably damaging Het
Tex15 C A 8: 33,574,730 T1396K possibly damaging Het
Zswim8 G T 14: 20,714,573 probably null Het
Other mutations in Mapk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03085:Mapk9 APN 11 49867038 missense probably damaging 1.00
IGL03399:Mapk9 APN 11 49883299 utr 3 prime probably benign
Infirm UTSW 11 49863556 missense probably damaging 1.00
R0003:Mapk9 UTSW 11 49867039 missense possibly damaging 0.52
R0610:Mapk9 UTSW 11 49863573 missense probably benign 0.00
R0676:Mapk9 UTSW 11 49883156 makesense probably null
R0681:Mapk9 UTSW 11 49869245 missense probably damaging 1.00
R0736:Mapk9 UTSW 11 49883254 missense possibly damaging 0.58
R1186:Mapk9 UTSW 11 49878269 missense probably damaging 0.99
R1964:Mapk9 UTSW 11 49854333 missense probably null 1.00
R2424:Mapk9 UTSW 11 49863672 missense probably damaging 1.00
R4876:Mapk9 UTSW 11 49854325 missense probably damaging 0.97
R6191:Mapk9 UTSW 11 49863556 missense probably damaging 1.00
R7484:Mapk9 UTSW 11 49872836 missense probably damaging 0.97
RF010:Mapk9 UTSW 11 49854256 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAATGCTGTGCACTAGGATGC -3'
(R):5'- AATGCTAGGCCTTATATACTACAGC -3'

Sequencing Primer
(F):5'- TGCACTAGGATGCTTTGGTAAC -3'
(R):5'- GGCCTTATATACTACAGCTCTGAG -3'
Posted On2019-08-16