Incidental Mutation 'R7100:Amdhd1'
ID 568538
Institutional Source Beutler Lab
Gene Symbol Amdhd1
Ensembl Gene ENSMUSG00000015890
Gene Name amidohydrolase domain containing 1
Synonyms 1300019J08Rik
MMRRC Submission 045192-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7100 (G1)
Quality Score 156.008
Status Validated
Chromosome 10
Chromosomal Location 93359200-93375895 bp(-) (GRCm39)
Type of Mutation splice site (185 bp from exon)
DNA Base Change (assembly) T to C at 93372936 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000016034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016034] [ENSMUST00000092215]
AlphaFold Q9DBA8
Predicted Effect probably null
Transcript: ENSMUST00000016034
SMART Domains Protein: ENSMUSP00000016034
Gene: ENSMUSG00000015890

DomainStartEndE-ValueType
Pfam:Amidohydro_1 78 423 3.6e-21 PFAM
Pfam:Amidohydro_3 107 424 8.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092215
SMART Domains Protein: ENSMUSP00000089860
Gene: ENSMUSG00000036168

DomainStartEndE-ValueType
Pfam:DUF4200 112 230 4.4e-28 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 317 333 N/A INTRINSIC
coiled coil region 388 412 N/A INTRINSIC
coiled coil region 479 522 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 A G 2: 154,394,315 (GRCm39) E89G probably damaging Het
Adgrv1 A T 13: 81,419,016 (GRCm39) V5993E probably damaging Het
Amph T C 13: 19,334,011 (GRCm39) *691Q probably null Het
Ankrd55 A G 13: 112,492,644 (GRCm39) K272E probably benign Het
Arhgef10l C T 4: 140,244,126 (GRCm39) V838I possibly damaging Het
Arl2 C A 19: 6,184,774 (GRCm39) V160F probably benign Het
Catsperb T C 12: 101,412,297 (GRCm39) V128A possibly damaging Het
Cdk11b T A 4: 155,710,050 (GRCm39) L17H probably damaging Het
Cpsf1 A T 15: 76,480,314 (GRCm39) N1391K possibly damaging Het
Cpxm2 C T 7: 131,656,544 (GRCm39) A573T probably benign Het
Cspg4b T A 13: 113,455,501 (GRCm39) F516I Het
Daxx T C 17: 34,130,416 (GRCm39) S144P probably damaging Het
Dpp3 T C 19: 4,968,069 (GRCm39) D303G probably damaging Het
Fam181a T A 12: 103,282,132 (GRCm39) N12K probably damaging Het
Flg2 A T 3: 93,111,018 (GRCm39) R1015S unknown Het
Fstl5 A G 3: 76,443,600 (GRCm39) H315R probably benign Het
Fut4 A G 9: 14,662,689 (GRCm39) S202P probably damaging Het
Gm5114 T C 7: 39,057,708 (GRCm39) D637G possibly damaging Het
Gstcd G T 3: 132,790,704 (GRCm39) T21K probably benign Het
Heca C T 10: 17,791,121 (GRCm39) V312M probably benign Het
Herpud1 A G 8: 95,117,475 (GRCm39) R144G probably damaging Het
Hycc2 T A 1: 58,573,653 (GRCm39) T384S possibly damaging Het
Ino80 A G 2: 119,204,994 (GRCm39) S1511P possibly damaging Het
Irf2bp2 T C 8: 127,318,472 (GRCm39) T365A probably benign Het
Klk1 G A 7: 43,878,848 (GRCm39) G214E probably damaging Het
Lama3 A T 18: 12,715,701 (GRCm39) N1719I possibly damaging Het
Lmna A G 3: 88,392,297 (GRCm39) I365T probably damaging Het
Lrp8 C A 4: 107,659,647 (GRCm39) A13E possibly damaging Het
Ly75 A G 2: 60,136,778 (GRCm39) L1483P probably benign Het
Maco1 T C 4: 134,533,971 (GRCm39) D550G probably damaging Het
Mid1 A G X: 168,768,073 (GRCm39) D407G probably benign Het
Mpl G T 4: 118,314,607 (GRCm39) A21E Het
Mus81 C T 19: 5,534,239 (GRCm39) G360S probably damaging Het
Nmt2 T A 2: 3,313,950 (GRCm39) S250T probably benign Het
Nr1d1 C A 11: 98,662,160 (GRCm39) R158L probably damaging Het
Pcgf6 G A 19: 47,039,153 (GRCm39) P36S unknown Het
Pcnx2 G A 8: 126,485,853 (GRCm39) A1915V probably benign Het
Peak1 A G 9: 56,166,677 (GRCm39) V417A probably damaging Het
Phf20l1 A G 15: 66,476,689 (GRCm39) N262S probably benign Het
Plaat5 T A 19: 7,616,923 (GRCm39) F313I unknown Het
Ppp2r5d A G 17: 46,996,608 (GRCm39) V355A probably benign Het
Rasa3 T C 8: 13,636,897 (GRCm39) T395A probably benign Het
Rims1 T A 1: 22,416,697 (GRCm39) I432F probably benign Het
Rnf123 C T 9: 107,933,838 (GRCm39) C1080Y probably damaging Het
Serpina3g T C 12: 104,204,570 (GRCm39) probably benign Het
Shank2 T A 7: 143,964,901 (GRCm39) D836E possibly damaging Het
Slc24a5 A C 2: 124,922,591 (GRCm39) S118R probably damaging Het
Smg1 G T 7: 117,783,743 (GRCm39) H1048N unknown Het
Specc1l T G 10: 75,081,329 (GRCm39) S242A probably benign Het
Tagap1 A T 17: 7,224,111 (GRCm39) L195Q possibly damaging Het
Trpc3 C A 3: 36,704,216 (GRCm39) E580D probably benign Het
Ttn A T 2: 76,541,166 (GRCm39) V33940E probably benign Het
Upp2 G T 2: 58,681,817 (GRCm39) R318L probably benign Het
Vezt T A 10: 93,832,795 (GRCm39) E205D probably benign Het
Vmn1r177 A G 7: 23,565,535 (GRCm39) F114L probably benign Het
Vmn2r53 C A 7: 12,315,513 (GRCm39) E769* probably null Het
Vnn3 T C 10: 23,741,840 (GRCm39) Y382H probably damaging Het
Other mutations in Amdhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Amdhd1 APN 10 93,367,430 (GRCm39) missense probably benign
IGL02336:Amdhd1 APN 10 93,360,291 (GRCm39) missense probably benign 0.23
IGL02538:Amdhd1 APN 10 93,363,108 (GRCm39) missense probably damaging 0.99
IGL03162:Amdhd1 APN 10 93,367,337 (GRCm39) splice site probably null
R0893:Amdhd1 UTSW 10 93,363,513 (GRCm39) missense probably damaging 1.00
R1857:Amdhd1 UTSW 10 93,367,416 (GRCm39) missense probably damaging 1.00
R2890:Amdhd1 UTSW 10 93,363,126 (GRCm39) missense probably benign 0.02
R4159:Amdhd1 UTSW 10 93,370,512 (GRCm39) missense probably damaging 1.00
R4768:Amdhd1 UTSW 10 93,370,346 (GRCm39) missense possibly damaging 0.88
R4941:Amdhd1 UTSW 10 93,367,463 (GRCm39) missense probably damaging 1.00
R5199:Amdhd1 UTSW 10 93,361,847 (GRCm39) missense probably damaging 1.00
R5917:Amdhd1 UTSW 10 93,360,332 (GRCm39) missense possibly damaging 0.95
R6831:Amdhd1 UTSW 10 93,363,118 (GRCm39) missense probably damaging 0.97
R7294:Amdhd1 UTSW 10 93,370,301 (GRCm39) missense probably benign 0.09
R7638:Amdhd1 UTSW 10 93,370,360 (GRCm39) nonsense probably null
R9046:Amdhd1 UTSW 10 93,363,087 (GRCm39) missense probably damaging 1.00
R9149:Amdhd1 UTSW 10 93,375,813 (GRCm39) missense probably damaging 1.00
R9763:Amdhd1 UTSW 10 93,367,398 (GRCm39) missense possibly damaging 0.76
R9779:Amdhd1 UTSW 10 93,370,474 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGAGATAGCCAGCTCTCATGTTC -3'
(R):5'- TTGCTCTGGGAAATGCGTC -3'

Sequencing Primer
(F):5'- GATAGCCAGCTCTCATGTTCAGTAAC -3'
(R):5'- CTATGTCTCCATCCACTGAA -3'
Posted On 2019-08-16