Incidental Mutation 'R7183:Pfkl'
ID568544
Institutional Source Beutler Lab
Gene Symbol Pfkl
Ensembl Gene ENSMUSG00000020277
Gene Namephosphofructokinase, liver, B-type
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7183 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location77986947-78010083 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 78002082 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 31 (R31*)
Ref Sequence ENSEMBL: ENSMUSP00000151375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020522] [ENSMUST00000145716] [ENSMUST00000218383]
Predicted Effect silent
Transcript: ENSMUST00000020522
SMART Domains Protein: ENSMUSP00000020522
Gene: ENSMUSG00000020277

DomainStartEndE-ValueType
Pfam:PFK 17 324 4.7e-109 PFAM
Pfam:PFK 401 686 1.9e-98 PFAM
Predicted Effect silent
Transcript: ENSMUST00000145716
Predicted Effect probably null
Transcript: ENSMUST00000218383
AA Change: R31*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the liver (L) subunit of an enzyme that catalyzes the conversion of D-fructose 6-phosphate to D-fructose 1,6-bisphosphate, which is a key step in glucose metabolism (glycolysis). This enzyme is a tetramer that may be composed of different subunits encoded by distinct genes in different tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,833 L1089F probably benign Het
Actn1 T A 12: 80,168,932 M816L possibly damaging Het
Ahnak T C 19: 9,017,668 F5439L probably damaging Het
Apba2 G A 7: 64,733,545 D369N probably benign Het
Arhgap32 A G 9: 32,186,383 N228D probably benign Het
Arhgap33 T A 7: 30,525,871 probably null Het
Cacna1g C T 11: 94,439,737 C984Y probably benign Het
Cadm2 C A 16: 66,882,832 G47* probably null Het
Ccdc125 A G 13: 100,690,358 D241G possibly damaging Het
Ccdc39 T G 3: 33,814,471 E822A probably damaging Het
Cd86 CA CAA 16: 36,606,555 probably null Het
Cdc42bpg A G 19: 6,310,797 D195G probably damaging Het
Cdkl1 T C 12: 69,748,932 R275G probably damaging Het
Chst4 T C 8: 110,029,998 N411S possibly damaging Het
Cir1 A G 2: 73,286,386 V210A probably damaging Het
Col6a1 A G 10: 76,716,259 probably null Het
Crmp1 C A 5: 37,288,817 H606N probably benign Het
Cyp2j8 A T 4: 96,479,181 N233K probably damaging Het
Dennd1b A T 1: 139,170,252 Q677L unknown Het
Dnah17 G A 11: 118,129,188 T11I probably benign Het
Ehd1 A G 19: 6,297,654 H346R probably benign Het
Emc3 G T 6: 113,531,384 Y33* probably null Het
Ercc5 A T 1: 44,161,808 probably null Het
Ercc5 G T 1: 44,161,809 probably null Het
Fat3 A C 9: 15,922,837 I4153S possibly damaging Het
Fn3krp T C 11: 121,421,605 probably null Het
Gm2035 G A 12: 87,919,722 R46W possibly damaging Het
Gmnc C T 16: 26,960,529 D249N probably benign Het
Gsn C T 2: 35,294,948 A305V probably benign Het
Haus6 A T 4: 86,583,752 H627Q possibly damaging Het
Heg1 A G 16: 33,738,550 probably null Het
Hoxd9 G T 2: 74,698,365 V104L possibly damaging Het
Igkv10-96 A C 6: 68,632,216 S32A probably benign Het
Kcnd2 G A 6: 21,216,437 V47M probably damaging Het
Mab21l3 C T 3: 101,815,153 V386M probably damaging Het
Masp2 A G 4: 148,612,157 S404G probably benign Het
Olfr1024 T A 2: 85,904,142 Q304L probably benign Het
Olfr1454 A G 19: 13,064,316 I302V probably benign Het
Olfr835 G T 9: 19,035,332 D70Y probably damaging Het
P4htm A T 9: 108,581,860 M291K possibly damaging Het
Pde6c T C 19: 38,133,090 S49P probably benign Het
Pdzd7 A G 19: 45,037,114 V314A probably benign Het
Phlpp2 C A 8: 109,939,953 P1038Q probably damaging Het
Pik3c2b T C 1: 133,066,465 S56P probably benign Het
Plec A G 15: 76,205,705 V145A unknown Het
Prg3 G A 2: 84,991,504 V158I probably benign Het
Prg3 G T 2: 84,993,023 D181Y probably damaging Het
Rbp3 A G 14: 33,955,204 T370A probably benign Het
Rgl2 T C 17: 33,934,990 F457L possibly damaging Het
Rubcnl T A 14: 75,049,626 M578K probably damaging Het
Siae G A 9: 37,616,946 V72M possibly damaging Het
Smchd1 A T 17: 71,353,516 D1864E probably benign Het
Smox T C 2: 131,520,566 I255T possibly damaging Het
Tas2r123 A G 6: 132,847,698 N186S possibly damaging Het
Thbs2 T A 17: 14,690,116 I74F possibly damaging Het
Timm44 T C 8: 4,267,311 D238G probably damaging Het
Tlk2 T C 11: 105,221,359 probably null Het
Tnc A G 4: 64,013,128 S782P probably damaging Het
Tpr A T 1: 150,406,551 K336N probably damaging Het
Uggt2 A T 14: 119,019,637 probably null Het
Vmn2r101 T A 17: 19,612,178 I812N probably damaging Het
Vps33a T C 5: 123,535,215 Q436R probably null Het
Ywhaq T C 12: 21,416,869 K75E possibly damaging Het
Zfp87 A G 13: 67,517,474 S290P probably damaging Het
Other mutations in Pfkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Pfkl APN 10 77991395 missense probably benign
IGL01759:Pfkl APN 10 78000731 missense probably damaging 1.00
IGL02697:Pfkl APN 10 77999918 missense probably benign 0.09
IGL02870:Pfkl APN 10 78000839 nonsense probably null
IGL02942:Pfkl APN 10 78000133 critical splice donor site probably null
IGL02972:Pfkl APN 10 77988274 missense probably benign 0.00
IGL03342:Pfkl APN 10 78005475 missense possibly damaging 0.95
ANU23:Pfkl UTSW 10 77991395 missense probably benign
R0226:Pfkl UTSW 10 77992534 missense probably benign 0.00
R0743:Pfkl UTSW 10 77995243 critical splice donor site probably null
R0899:Pfkl UTSW 10 78005439 critical splice donor site probably null
R0926:Pfkl UTSW 10 78000689 missense probably damaging 1.00
R1264:Pfkl UTSW 10 77993416 missense possibly damaging 0.46
R1782:Pfkl UTSW 10 77988720 missense probably benign 0.00
R1918:Pfkl UTSW 10 78001426 missense probably damaging 1.00
R3743:Pfkl UTSW 10 77996345 missense probably damaging 1.00
R4559:Pfkl UTSW 10 77988883 missense probably benign 0.00
R4804:Pfkl UTSW 10 77991394 missense probably benign
R4823:Pfkl UTSW 10 77997594 missense probably damaging 1.00
R4906:Pfkl UTSW 10 77988310 missense probably damaging 1.00
R5082:Pfkl UTSW 10 77996408 missense probably damaging 1.00
R5216:Pfkl UTSW 10 78009670 missense probably damaging 0.99
R5380:Pfkl UTSW 10 77997589 missense possibly damaging 0.86
R5816:Pfkl UTSW 10 78002022 missense possibly damaging 0.75
R5840:Pfkl UTSW 10 77988724 missense probably benign
R5888:Pfkl UTSW 10 77991370 missense possibly damaging 0.68
R6143:Pfkl UTSW 10 77989613 missense probably damaging 0.96
R6152:Pfkl UTSW 10 77990151 missense probably benign 0.00
R6251:Pfkl UTSW 10 77989565 critical splice donor site probably null
R6262:Pfkl UTSW 10 77988673 critical splice donor site probably null
R6382:Pfkl UTSW 10 77999837 missense probably damaging 0.98
R6407:Pfkl UTSW 10 77988673 critical splice donor site probably null
R6547:Pfkl UTSW 10 77995354 missense probably benign
R6704:Pfkl UTSW 10 77996366 missense probably damaging 1.00
R6996:Pfkl UTSW 10 77997589 missense probably damaging 1.00
R7116:Pfkl UTSW 10 78001415 missense probably benign
R7154:Pfkl UTSW 10 78001455 missense probably benign 0.41
R7248:Pfkl UTSW 10 77989589 missense probably damaging 1.00
R7252:Pfkl UTSW 10 77993429 missense probably damaging 1.00
R7278:Pfkl UTSW 10 77992023 missense probably damaging 0.99
R7974:Pfkl UTSW 10 77994162 missense probably damaging 1.00
R8686:Pfkl UTSW 10 77997522 critical splice donor site probably null
R8900:Pfkl UTSW 10 78000781 missense probably damaging 1.00
X0026:Pfkl UTSW 10 77989643 missense probably damaging 1.00
Z1176:Pfkl UTSW 10 78000136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCCCTGGTCTAGACTATTATG -3'
(R):5'- GCAGACCTTTAGGCATGTGG -3'

Sequencing Primer
(F):5'- CCCTGGTCTAGACTATTATGTCTTGG -3'
(R):5'- ATGTGGAGCATGCTCAGAGTCC -3'
Posted On2019-08-19