Mutagenetix > Incidental Mutation

Incidental Mutation 'R7183:Pfkl'

568544

Institutional Source

Beutler Lab

Gene Symbol

Pfkl

Ensembl Gene

ENSMUSG00000020277

Gene Name

phosphofructokinase, liver, B-type

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7183 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77986947-78010083 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 78002082 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 31 (R31*)

Ref Sequence

ENSEMBL: ENSMUSP00000151375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020522] [ENSMUST00000145716] [ENSMUST00000218383]

AlphaFold

P12382

Predicted Effect

silent
Transcript: ENSMUST00000020522

SMART Domains

Protein: ENSMUSP00000020522
Gene: ENSMUSG00000020277

Domain	Start	End	E-Value	Type
Pfam:PFK	17	324	4.7e-109	PFAM
Pfam:PFK	401	686	1.9e-98	PFAM

Predicted Effect

silent
Transcript: ENSMUST00000145716

Predicted Effect

probably null
Transcript: ENSMUST00000218383
AA Change: R31*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the liver (L) subunit of an enzyme that catalyzes the conversion of D-fructose 6-phosphate to D-fructose 1,6-bisphosphate, which is a key step in glucose metabolism (glycolysis). This enzyme is a tetramer that may be composed of different subunits encoded by distinct genes in different tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	A	1: 26,682,833	L1089F	probably benign	Het
Actn1	T	A	12: 80,168,932	M816L	possibly damaging	Het
Ahnak	T	C	19: 9,017,668	F5439L	probably damaging	Het
Apba2	G	A	7: 64,733,545	D369N	probably benign	Het
Arhgap32	A	G	9: 32,186,383	N228D	probably benign	Het
Arhgap33	T	A	7: 30,525,871		probably null	Het
Cacna1g	C	T	11: 94,439,737	C984Y	probably benign	Het
Cadm2	C	A	16: 66,882,832	G47*	probably null	Het
Ccdc125	A	G	13: 100,690,358	D241G	possibly damaging	Het
Ccdc39	T	G	3: 33,814,471	E822A	probably damaging	Het
Cd86	CA	CAA	16: 36,606,555		probably null	Het
Cdc42bpg	A	G	19: 6,310,797	D195G	probably damaging	Het
Cdkl1	T	C	12: 69,748,932	R275G	probably damaging	Het
Chst4	T	C	8: 110,029,998	N411S	possibly damaging	Het
Cir1	A	G	2: 73,286,386	V210A	probably damaging	Het
Col6a1	A	G	10: 76,716,259		probably null	Het
Crmp1	C	A	5: 37,288,817	H606N	probably benign	Het
Cyp2j8	A	T	4: 96,479,181	N233K	probably damaging	Het
Dennd1b	A	T	1: 139,170,252	Q677L	unknown	Het
Dnah17	G	A	11: 118,129,188	T11I	probably benign	Het
Ehd1	A	G	19: 6,297,654	H346R	probably benign	Het
Emc3	G	T	6: 113,531,384	Y33*	probably null	Het
Ercc5	A	T	1: 44,161,808		probably null	Het
Ercc5	G	T	1: 44,161,809		probably null	Het
Fat3	A	C	9: 15,922,837	I4153S	possibly damaging	Het
Fn3krp	T	C	11: 121,421,605		probably null	Het
Gm2035	G	A	12: 87,919,722	R46W	possibly damaging	Het
Gmnc	C	T	16: 26,960,529	D249N	probably benign	Het
Gsn	C	T	2: 35,294,948	A305V	probably benign	Het
Haus6	A	T	4: 86,583,752	H627Q	possibly damaging	Het
Heg1	A	G	16: 33,738,550		probably null	Het
Hoxd9	G	T	2: 74,698,365	V104L	possibly damaging	Het
Igkv10-96	A	C	6: 68,632,216	S32A	probably benign	Het
Kcnd2	G	A	6: 21,216,437	V47M	probably damaging	Het
Mab21l3	C	T	3: 101,815,153	V386M	probably damaging	Het
Masp2	A	G	4: 148,612,157	S404G	probably benign	Het
Olfr1024	T	A	2: 85,904,142	Q304L	probably benign	Het
Olfr1454	A	G	19: 13,064,316	I302V	probably benign	Het
Olfr835	G	T	9: 19,035,332	D70Y	probably damaging	Het
P4htm	A	T	9: 108,581,860	M291K	possibly damaging	Het
Pde6c	T	C	19: 38,133,090	S49P	probably benign	Het
Pdzd7	A	G	19: 45,037,114	V314A	probably benign	Het
Phlpp2	C	A	8: 109,939,953	P1038Q	probably damaging	Het
Pik3c2b	T	C	1: 133,066,465	S56P	probably benign	Het
Plec	A	G	15: 76,205,705	V145A	unknown	Het
Prg3	G	A	2: 84,991,504	V158I	probably benign	Het
Prg3	G	T	2: 84,993,023	D181Y	probably damaging	Het
Rbp3	A	G	14: 33,955,204	T370A	probably benign	Het
Rgl2	T	C	17: 33,934,990	F457L	possibly damaging	Het
Rubcnl	T	A	14: 75,049,626	M578K	probably damaging	Het
Siae	G	A	9: 37,616,946	V72M	possibly damaging	Het
Smchd1	A	T	17: 71,353,516	D1864E	probably benign	Het
Smox	T	C	2: 131,520,566	I255T	possibly damaging	Het
Tas2r123	A	G	6: 132,847,698	N186S	possibly damaging	Het
Thbs2	T	A	17: 14,690,116	I74F	possibly damaging	Het
Timm44	T	C	8: 4,267,311	D238G	probably damaging	Het
Tlk2	T	C	11: 105,221,359		probably null	Het
Tnc	A	G	4: 64,013,128	S782P	probably damaging	Het
Tpr	A	T	1: 150,406,551	K336N	probably damaging	Het
Uggt2	A	T	14: 119,019,637		probably null	Het
Vmn2r101	T	A	17: 19,612,178	I812N	probably damaging	Het
Vps33a	T	C	5: 123,535,215	Q436R	probably null	Het
Ywhaq	T	C	12: 21,416,869	K75E	possibly damaging	Het
Zfp87	A	G	13: 67,517,474	S290P	probably damaging	Het

Other mutations in Pfkl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01306:Pfkl	APN	10	77991395	missense	probably benign
IGL01759:Pfkl	APN	10	78000731	missense	probably damaging	1.00
IGL02697:Pfkl	APN	10	77999918	missense	probably benign	0.09
IGL02870:Pfkl	APN	10	78000839	nonsense	probably null
IGL02942:Pfkl	APN	10	78000133	critical splice donor site	probably null
IGL02972:Pfkl	APN	10	77988274	missense	probably benign	0.00
IGL03342:Pfkl	APN	10	78005475	missense	possibly damaging	0.95
ANU23:Pfkl	UTSW	10	77991395	missense	probably benign
R0226:Pfkl	UTSW	10	77992534	missense	probably benign	0.00
R0743:Pfkl	UTSW	10	77995243	critical splice donor site	probably null
R0899:Pfkl	UTSW	10	78005439	critical splice donor site	probably null
R0926:Pfkl	UTSW	10	78000689	missense	probably damaging	1.00
R1264:Pfkl	UTSW	10	77993416	missense	possibly damaging	0.46
R1782:Pfkl	UTSW	10	77988720	missense	probably benign	0.00
R1918:Pfkl	UTSW	10	78001426	missense	probably damaging	1.00
R3743:Pfkl	UTSW	10	77996345	missense	probably damaging	1.00
R4559:Pfkl	UTSW	10	77988883	missense	probably benign	0.00
R4804:Pfkl	UTSW	10	77991394	missense	probably benign
R4823:Pfkl	UTSW	10	77997594	missense	probably damaging	1.00
R4906:Pfkl	UTSW	10	77988310	missense	probably damaging	1.00
R5082:Pfkl	UTSW	10	77996408	missense	probably damaging	1.00
R5216:Pfkl	UTSW	10	78009670	missense	probably damaging	0.99
R5380:Pfkl	UTSW	10	77997589	missense	possibly damaging	0.86
R5816:Pfkl	UTSW	10	78002022	missense	possibly damaging	0.75
R5840:Pfkl	UTSW	10	77988724	missense	probably benign
R5888:Pfkl	UTSW	10	77991370	missense	possibly damaging	0.68
R6143:Pfkl	UTSW	10	77989613	missense	probably damaging	0.96
R6152:Pfkl	UTSW	10	77990151	missense	probably benign	0.00
R6251:Pfkl	UTSW	10	77989565	critical splice donor site	probably null
R6262:Pfkl	UTSW	10	77988673	critical splice donor site	probably null
R6382:Pfkl	UTSW	10	77999837	missense	probably damaging	0.98
R6407:Pfkl	UTSW	10	77988673	critical splice donor site	probably null
R6547:Pfkl	UTSW	10	77995354	missense	probably benign
R6704:Pfkl	UTSW	10	77996366	missense	probably damaging	1.00
R6996:Pfkl	UTSW	10	77997589	missense	probably damaging	1.00
R7116:Pfkl	UTSW	10	78001415	missense	probably benign
R7154:Pfkl	UTSW	10	78001455	missense	probably benign	0.41
R7248:Pfkl	UTSW	10	77989589	missense	probably damaging	1.00
R7252:Pfkl	UTSW	10	77993429	missense	probably damaging	1.00
R7278:Pfkl	UTSW	10	77992023	missense	probably damaging	0.99
R7974:Pfkl	UTSW	10	77994162	missense	probably damaging	1.00
R8686:Pfkl	UTSW	10	77997522	critical splice donor site	probably null
R8900:Pfkl	UTSW	10	78000781	missense	probably damaging	1.00
R9015:Pfkl	UTSW	10	77988960	missense	probably damaging	0.98
R9090:Pfkl	UTSW	10	77997592	missense	probably benign	0.28
R9257:Pfkl	UTSW	10	77989655	missense	probably damaging	1.00
R9271:Pfkl	UTSW	10	77997592	missense	probably benign	0.28
R9415:Pfkl	UTSW	10	77988247	missense	probably damaging	1.00
R9439:Pfkl	UTSW	10	77995338	missense	probably damaging	1.00
R9486:Pfkl	UTSW	10	77988350	missense	probably benign
R9703:Pfkl	UTSW	10	77990308	critical splice acceptor site	probably null
X0026:Pfkl	UTSW	10	77989643	missense	probably damaging	1.00
Z1176:Pfkl	UTSW	10	78000136	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTCCCTGGTCTAGACTATTATG -3'
(R):5'- GCAGACCTTTAGGCATGTGG -3'

Sequencing Primer
(F):5'- CCCTGGTCTAGACTATTATGTCTTGG -3'
(R):5'- ATGTGGAGCATGCTCAGAGTCC -3'

Posted On

2019-08-19