Incidental Mutation 'R7182:Ccdc33'
ID 568551
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Name coiled-coil domain containing 33
Synonyms LOC382077, 4930535E21Rik
MMRRC Submission 045234-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7182 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 57935960-58026106 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 57941456 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000215944]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000042205
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098682
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119665
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000215944
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (70/73)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,667,578 (GRCm39) V323A unknown Het
AC117241.1 A G 17: 7,620,087 (GRCm39) V158A unknown Het
Acadm A G 3: 153,647,518 (GRCm39) probably null Het
Adcy10 T G 1: 165,371,039 (GRCm39) probably null Het
Aldh6a1 C T 12: 84,488,605 (GRCm39) A94T probably benign Het
Ano2 T A 6: 125,767,256 (GRCm39) L229Q probably damaging Het
Cacna1h C T 17: 25,596,629 (GRCm39) R1828H probably damaging Het
Cep112 A C 11: 108,573,670 (GRCm39) D6A probably benign Het
Chd9 T C 8: 91,733,250 (GRCm39) F1373S unknown Het
Cog5 T C 12: 31,735,707 (GRCm39) L158P probably damaging Het
Col6a3 G A 1: 90,731,400 (GRCm39) Q1618* probably null Het
Dlg5 A G 14: 24,294,924 (GRCm39) V3A Het
Dnah7a T A 1: 53,659,620 (GRCm39) probably null Het
Dpp10 A T 1: 123,268,880 (GRCm39) H716Q probably benign Het
Epor A G 9: 21,874,625 (GRCm39) F35L probably benign Het
Ergic1 A T 17: 26,873,856 (GRCm39) Y92F Het
Fam98a G A 17: 75,846,013 (GRCm39) Q273* probably null Het
Fhdc1 G A 3: 84,356,157 (GRCm39) T429I probably damaging Het
Fmnl2 T A 2: 52,997,453 (GRCm39) L468Q unknown Het
Fmnl3 C T 15: 99,219,663 (GRCm39) R695Q probably damaging Het
Gabrg2 T C 11: 41,811,333 (GRCm39) M271V probably damaging Het
Garin4 C T 1: 190,895,548 (GRCm39) R365H probably damaging Het
Gk5 G T 9: 96,001,579 (GRCm39) V26L possibly damaging Het
Gm14412 A C 2: 177,007,408 (GRCm39) N162K probably benign Het
Gm3604 T C 13: 62,519,689 (GRCm39) D22G probably damaging Het
Gm5565 G T 5: 146,094,865 (GRCm39) H294N probably benign Het
Hsf2 T A 10: 57,381,272 (GRCm39) D287E possibly damaging Het
Ift70b A T 2: 75,768,293 (GRCm39) Y153* probably null Het
Impdh2 G A 9: 108,440,407 (GRCm39) R231H possibly damaging Het
Irak3 T C 10: 120,002,416 (GRCm39) H234R probably damaging Het
Lrba GTTCCCTTC GTTC 3: 86,648,765 (GRCm39) probably null Het
Lrch3 T A 16: 32,814,149 (GRCm39) D551E probably benign Het
Manba A T 3: 135,273,274 (GRCm39) N736I probably benign Het
Map2 A G 1: 66,451,812 (GRCm39) D234G possibly damaging Het
Mdk C A 2: 91,761,197 (GRCm39) K121N unknown Het
Mfn1 T A 3: 32,618,369 (GRCm39) L526Q probably damaging Het
Mfsd2b A G 12: 4,916,157 (GRCm39) probably null Het
Mnat1 G T 12: 73,277,452 (GRCm39) E233* probably null Het
Mtmr4 T C 11: 87,495,431 (GRCm39) probably null Het
Mtrf1 A G 14: 79,660,904 (GRCm39) E432G possibly damaging Het
Muc5b C T 7: 141,396,382 (GRCm39) R165C unknown Het
Naip6 T A 13: 100,452,657 (GRCm39) I135F probably benign Het
Nod2 A G 8: 89,390,460 (GRCm39) T256A probably benign Het
Notch4 T A 17: 34,802,473 (GRCm39) V1298E probably damaging Het
Nudc G T 4: 133,261,776 (GRCm39) D169E possibly damaging Het
Obscn A T 11: 58,925,927 (GRCm39) I5602N probably damaging Het
Or5b114-ps1 G A 19: 13,353,208 (GRCm39) G294E unknown Het
Osbpl10 G A 9: 114,896,319 (GRCm39) D18N probably damaging Het
Pigk G A 3: 152,428,188 (GRCm39) V72I possibly damaging Het
Prl8a6 C T 13: 27,621,153 (GRCm39) E26K probably damaging Het
Prpf8 A G 11: 75,381,553 (GRCm39) Y318C possibly damaging Het
Rab13 A G 3: 90,132,070 (GRCm39) D159G possibly damaging Het
Rgl2 T C 17: 34,153,964 (GRCm39) F457L possibly damaging Het
Ryr2 T C 13: 11,774,643 (GRCm39) H1171R probably benign Het
Scn4a T A 11: 106,221,134 (GRCm39) I842F probably benign Het
Scnm1 A T 3: 95,041,165 (GRCm39) N14K possibly damaging Het
Serinc1 A T 10: 57,400,457 (GRCm39) I137N probably benign Het
Slc30a3 T C 5: 31,244,169 (GRCm39) Q371R probably benign Het
Slc30a3 A C 5: 31,247,014 (GRCm39) M103R probably damaging Het
Slco1a1 A T 6: 141,857,565 (GRCm39) C589S probably damaging Het
Slco1b2 A G 6: 141,602,656 (GRCm39) Y203C probably damaging Het
Spty2d1 A T 7: 46,648,271 (GRCm39) D219E probably benign Het
Svep1 A T 4: 58,043,991 (GRCm39) S3552T probably benign Het
Tmem62 A G 2: 120,835,224 (GRCm39) I516M probably benign Het
Trim61 A T 8: 65,466,266 (GRCm39) S332T probably damaging Het
Trmt10b A C 4: 45,308,520 (GRCm39) T227P probably benign Het
Trpc3 T C 3: 36,709,258 (GRCm39) Q406R probably benign Het
Ush2a A T 1: 188,485,740 (GRCm39) Y2950F probably benign Het
Usp32 C T 11: 84,930,996 (GRCm39) G478D probably benign Het
Wdfy3 A G 5: 102,091,758 (GRCm39) L527P possibly damaging Het
Wdr73 A G 7: 80,543,426 (GRCm39) V163A possibly damaging Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 57,977,257 (GRCm39) splice site probably benign
IGL01403:Ccdc33 APN 9 58,024,668 (GRCm39) missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58,024,919 (GRCm39) splice site probably benign
IGL01714:Ccdc33 APN 9 57,937,153 (GRCm39) missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 57,983,861 (GRCm39) missense probably benign 0.13
IGL02158:Ccdc33 APN 9 57,937,702 (GRCm39) missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 57,940,938 (GRCm39) missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58,005,874 (GRCm39) missense probably benign 0.43
R0276:Ccdc33 UTSW 9 57,965,675 (GRCm39) missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58,024,737 (GRCm39) missense probably damaging 1.00
R0737:Ccdc33 UTSW 9 57,989,331 (GRCm39) missense probably damaging 0.99
R0789:Ccdc33 UTSW 9 58,024,497 (GRCm39) splice site probably benign
R0791:Ccdc33 UTSW 9 57,936,046 (GRCm39) missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 57,940,955 (GRCm39) missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58,024,749 (GRCm39) missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58,024,729 (GRCm39) missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 57,939,991 (GRCm39) missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58,024,445 (GRCm39) nonsense probably null
R1982:Ccdc33 UTSW 9 58,024,451 (GRCm39) missense probably benign 0.07
R2044:Ccdc33 UTSW 9 57,938,395 (GRCm39) missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 57,989,305 (GRCm39) missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 57,989,305 (GRCm39) missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 57,989,305 (GRCm39) missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 57,983,913 (GRCm39) missense probably benign 0.44
R3899:Ccdc33 UTSW 9 57,940,200 (GRCm39) missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 57,977,155 (GRCm39) missense possibly damaging 0.67
R4468:Ccdc33 UTSW 9 57,937,235 (GRCm39) missense possibly damaging 0.93
R4703:Ccdc33 UTSW 9 57,940,953 (GRCm39) missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58,024,840 (GRCm39) missense probably benign 0.01
R4790:Ccdc33 UTSW 9 57,937,240 (GRCm39) missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 57,974,818 (GRCm39) missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 57,974,839 (GRCm39) missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 57,977,134 (GRCm39) missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58,025,918 (GRCm39) missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 57,940,267 (GRCm39) missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 57,993,860 (GRCm39) missense probably benign 0.00
R5528:Ccdc33 UTSW 9 57,936,078 (GRCm39) missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58,024,450 (GRCm39) missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 57,937,235 (GRCm39) missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 57,940,489 (GRCm39) splice site probably benign
R5975:Ccdc33 UTSW 9 58,024,761 (GRCm39) missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 57,993,883 (GRCm39) missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58,009,201 (GRCm39) splice site probably null
R6363:Ccdc33 UTSW 9 58,021,618 (GRCm39) missense probably benign 0.00
R6610:Ccdc33 UTSW 9 57,976,419 (GRCm39) missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 57,940,527 (GRCm39) missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58,019,267 (GRCm39) makesense probably null
R7121:Ccdc33 UTSW 9 57,988,167 (GRCm39) missense probably benign 0.00
R7239:Ccdc33 UTSW 9 57,940,192 (GRCm39) nonsense probably null
R7655:Ccdc33 UTSW 9 58,025,748 (GRCm39) missense probably damaging 0.97
R7656:Ccdc33 UTSW 9 58,025,748 (GRCm39) missense probably damaging 0.97
R7868:Ccdc33 UTSW 9 57,976,374 (GRCm39) missense probably benign
R8215:Ccdc33 UTSW 9 57,939,995 (GRCm39) missense probably benign 0.18
R9139:Ccdc33 UTSW 9 57,983,842 (GRCm39) missense probably benign 0.04
R9204:Ccdc33 UTSW 9 57,938,388 (GRCm39) missense probably benign 0.33
R9280:Ccdc33 UTSW 9 57,965,549 (GRCm39) missense probably benign
R9297:Ccdc33 UTSW 9 57,993,876 (GRCm39) missense possibly damaging 0.85
R9318:Ccdc33 UTSW 9 57,993,876 (GRCm39) missense possibly damaging 0.85
R9361:Ccdc33 UTSW 9 58,024,908 (GRCm39) missense possibly damaging 0.96
R9664:Ccdc33 UTSW 9 57,993,855 (GRCm39) missense possibly damaging 0.85
RF003:Ccdc33 UTSW 9 57,965,574 (GRCm39) missense probably benign 0.18
Z1176:Ccdc33 UTSW 9 58,024,699 (GRCm39) missense probably benign 0.01
Z1177:Ccdc33 UTSW 9 58,025,868 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TCTCAAAAGGATGGAGCCATG -3'
(R):5'- GCCCTGTACGTATATAGGCAGAC -3'

Sequencing Primer
(F):5'- AAGGATGGAGCCATGTTTCTAGATCC -3'
(R):5'- ACTCCTAACACTGAGTAGGTTGC -3'
Posted On 2019-08-19