Incidental Mutation 'R7140:Tmem45b'
ID568552
Institutional Source Beutler Lab
Gene Symbol Tmem45b
Ensembl Gene ENSMUSG00000041737
Gene Nametransmembrane protein 45b
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7140 (G1)
Quality Score186.009
Status Validated
Chromosome9
Chromosomal Location31426196-31464462 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 31434484 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048050] [ENSMUST00000213807] [ENSMUST00000217007]
Predicted Effect probably null
Transcript: ENSMUST00000048050
SMART Domains Protein: ENSMUSP00000042313
Gene: ENSMUSG00000041737

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 93 115 N/A INTRINSIC
Pfam:DUF716 117 238 2.8e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213807
Predicted Effect probably benign
Transcript: ENSMUST00000217007
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra2 T C 8: 27,120,901 probably null Het
Ap2a2 G A 7: 141,598,864 A148T probably benign Het
Arhgef3 A T 14: 27,401,707 N442Y probably damaging Het
B3gat3 A G 19: 8,925,852 Y191C probably damaging Het
B430306N03Rik A T 17: 48,322,455 K203* probably null Het
C1qtnf6 T A 15: 78,525,083 Y188F probably benign Het
Capn10 T C 1: 92,945,271 V573A possibly damaging Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ccdc43 G T 11: 102,688,869 probably null Het
Ccng2 C A 5: 93,268,755 P45Q probably benign Het
Cd86 T C 16: 36,620,901 H68R probably benign Het
Cmtm4 A G 8: 104,355,195 Y187H probably damaging Het
Cst11 T C 2: 148,768,729 N134S probably benign Het
Cyp3a25 A T 5: 146,003,045 F51I probably benign Het
Dnhd1 A G 7: 105,693,766 E1439G probably benign Het
Dock4 T C 12: 40,636,159 V131A probably benign Het
Dpysl2 A G 14: 66,862,533 S85P probably benign Het
Dync1i2 A G 2: 71,247,939 H324R probably benign Het
Elf1 A G 14: 79,567,270 D162G probably benign Het
Eri3 G A 4: 117,649,407 probably null Het
Fbxl21 T C 13: 56,532,332 S203P probably damaging Het
Foxi1 G A 11: 34,205,758 R291C probably damaging Het
Gm13089 T G 4: 143,698,432 H147P probably benign Het
Gprin3 C T 6: 59,355,143 A60T possibly damaging Het
Hecw1 A G 13: 14,316,533 C212R probably benign Het
Hivep3 T C 4: 120,097,121 L878P probably damaging Het
Hs6st3 A T 14: 119,139,102 N230Y probably damaging Het
Htr3b A G 9: 48,937,141 V268A possibly damaging Het
Ip6k3 T C 17: 27,144,995 T360A probably damaging Het
Izumo1 A G 7: 45,626,112 T282A probably benign Het
Kidins220 T A 12: 25,036,624 I1019N probably damaging Het
Med13l T C 5: 118,741,972 V1043A probably benign Het
Mon2 C T 10: 123,035,453 V420I probably benign Het
Naip6 T A 13: 100,300,200 Y605F possibly damaging Het
Nek7 A G 1: 138,487,055 I285T probably benign Het
Notch3 A G 17: 32,156,377 V357A possibly damaging Het
Nrxn1 G A 17: 91,088,764 probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1009 T A 2: 85,721,474 L23Q probably damaging Het
Olfr1200 G A 2: 88,767,964 A117V probably damaging Het
Olfr1362 C T 13: 21,611,127 V281M possibly damaging Het
Olfr821 T G 10: 130,034,214 M196R possibly damaging Het
Ostm1 C T 10: 42,683,272 A176V probably null Het
Pabpc6 C A 17: 9,668,428 S398I possibly damaging Het
Pcdhac2 C A 18: 37,144,186 P73H possibly damaging Het
Pcdhga9 A G 18: 37,739,131 D671G possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pigu A C 2: 155,301,240 L248R possibly damaging Het
Pinx1 C A 14: 63,860,385 probably null Het
Pon3 T C 6: 5,221,664 N322S possibly damaging Het
Rnft1 A G 11: 86,491,760 I270V probably benign Het
Scgb2b11 A G 7: 32,210,581 F27L probably damaging Het
Slc5a4b C T 10: 76,075,109 V298I probably damaging Het
Slco1a6 T A 6: 142,103,019 H345L probably benign Het
Sox1 C T 8: 12,397,405 P349S possibly damaging Het
Spata31 A G 13: 64,921,099 N354D probably benign Het
Speg T C 1: 75,406,770 probably null Het
Stpg1 T C 4: 135,533,722 I281T probably benign Het
Sult3a1 T C 10: 33,877,287 L193P probably damaging Het
Tenm3 A T 8: 48,292,236 C1097S probably damaging Het
Tfap2a A G 13: 40,730,047 S7P probably benign Het
Tlr1 T C 5: 64,925,678 I519V probably benign Het
Tmem238 A G 7: 4,789,073 V157A possibly damaging Het
Togaram2 A T 17: 71,714,766 H742L probably benign Het
Trpc7 A T 13: 56,789,674 Y656* probably null Het
Wdr35 T A 12: 9,022,785 Y920N probably damaging Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zfp759 A T 13: 67,140,113 H576L possibly damaging Het
Zfp958 G T 8: 4,628,481 A169S probably benign Het
Other mutations in Tmem45b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02269:Tmem45b APN 9 31427983 nonsense probably null
PIT4403001:Tmem45b UTSW 9 31426892 missense probably benign 0.01
R0689:Tmem45b UTSW 9 31428583 missense probably benign 0.05
R1845:Tmem45b UTSW 9 31431355 missense probably damaging 0.99
R1874:Tmem45b UTSW 9 31429087 missense probably damaging 1.00
R2147:Tmem45b UTSW 9 31428981 missense probably benign 0.01
R4584:Tmem45b UTSW 9 31428655 missense probably damaging 1.00
R5308:Tmem45b UTSW 9 31429084 missense probably damaging 0.97
R5472:Tmem45b UTSW 9 31428044 missense possibly damaging 0.94
R6564:Tmem45b UTSW 9 31428005 missense probably damaging 1.00
R7145:Tmem45b UTSW 9 31429041 missense probably damaging 1.00
R7154:Tmem45b UTSW 9 31428032 missense possibly damaging 0.88
R7419:Tmem45b UTSW 9 31428038 missense probably benign 0.01
Z1088:Tmem45b UTSW 9 31428027 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTCCTTGGGTATTAGCTGAC -3'
(R):5'- CACCGGCTTCAGGCTATTTG -3'

Sequencing Primer
(F):5'- ATTAGCTGACTTGGGTGTTCC -3'
(R):5'- GGTTCTACCCAAACATGGATATCAG -3'
Posted On2019-08-23