Incidental Mutation 'R7141:Aamp'
ID568557
Institutional Source Beutler Lab
Gene Symbol Aamp
Ensembl Gene ENSMUSG00000006299
Gene Nameangio-associated migratory protein
SynonymsAamp-rs
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R7141 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74279840-74284738 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to C at 74284111 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006462] [ENSMUST00000016309] [ENSMUST00000027370] [ENSMUST00000077985] [ENSMUST00000087226] [ENSMUST00000113796] [ENSMUST00000113805] [ENSMUST00000178235] [ENSMUST00000187046] [ENSMUST00000190008]
Predicted Effect probably benign
Transcript: ENSMUST00000006462
SMART Domains Protein: ENSMUSP00000006462
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 34 42 N/A INTRINSIC
low complexity region 46 64 N/A INTRINSIC
WD40 81 121 2.76e-2 SMART
WD40 124 163 4.83e-7 SMART
WD40 166 203 7.96e0 SMART
WD40 205 244 2.51e-5 SMART
WD40 247 289 2.38e-6 SMART
WD40 292 346 2.47e1 SMART
WD40 349 387 2.61e-3 SMART
WD40 390 429 1.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000016309
SMART Domains Protein: ENSMUSP00000016309
Gene: ENSMUSG00000006301

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
Pfam:Bax1-I 94 305 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000027370
SMART Domains Protein: ENSMUSP00000027370
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 1e-24 BLAST
Lactamase_B 129 291 1.05e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077985
SMART Domains Protein: ENSMUSP00000077135
Gene: ENSMUSG00000064272

DomainStartEndE-ValueType
Pfam:7tm_1 30 264 7.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087226
SMART Domains Protein: ENSMUSP00000084478
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
low complexity region 43 61 N/A INTRINSIC
Pfam:DUF4748 71 121 2.9e-23 PFAM
Lactamase_B 168 330 1.05e-31 SMART
Pfam:HAGH_C 331 421 6.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113796
SMART Domains Protein: ENSMUSP00000109427
Gene: ENSMUSG00000006301

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
Pfam:Bax1-I 94 305 4.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113805
SMART Domains Protein: ENSMUSP00000109436
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 4e-28 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000178235
SMART Domains Protein: ENSMUSP00000136644
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 47 65 N/A INTRINSIC
WD40 82 122 2.76e-2 SMART
WD40 125 164 4.83e-7 SMART
WD40 167 204 7.96e0 SMART
WD40 206 245 2.51e-5 SMART
WD40 248 290 2.38e-6 SMART
WD40 293 347 2.47e1 SMART
WD40 350 388 2.61e-3 SMART
WD40 391 430 1.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187046
SMART Domains Protein: ENSMUSP00000139411
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
WD40 20 60 1.7e-4 SMART
WD40 63 102 3e-9 SMART
WD40 120 160 1.7e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190008
SMART Domains Protein: ENSMUSP00000140427
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
low complexity region 40 58 N/A INTRINSIC
Meta Mutation Damage Score 0.7060 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the immunoglobulin superfamily. The encoded protein is associated with angiogenesis, with potential roles in endothelial tube formation and the migration of endothelial cells. It may also regulate smooth muscle cell migration via the RhoA pathway. The encoded protein can bind to heparin and may mediate heparin-sensitive cell adhesion. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 C T 16: 45,742,806 R29Q probably benign Het
Adgrv1 A G 13: 81,492,501 Y3369H probably benign Het
Agl A G 3: 116,753,286 I1305T probably benign Het
Apba3 A G 10: 81,273,055 I551V probably damaging Het
Appbp2 A T 11: 85,191,751 Y551* probably null Het
Btbd17 T C 11: 114,791,815 N357S possibly damaging Het
Casp2 T C 6: 42,280,395 F426S possibly damaging Het
Cdh5 A G 8: 104,113,001 N35D probably benign Het
Cep350 G T 1: 155,914,748 Q1354K probably damaging Het
Cep44 A G 8: 56,539,851 C243R probably damaging Het
Chst4 A T 8: 110,030,839 S131T probably damaging Het
Cox15 T C 19: 43,736,747 N406D probably benign Het
Cttnbp2 C T 6: 18,380,468 R1467H probably benign Het
Dock8 A G 19: 25,181,620 D1714G probably null Het
Erbb2 G T 11: 98,427,309 R457L probably damaging Het
Esyt3 T C 9: 99,321,440 N463S probably benign Het
Fam171a1 C T 2: 3,225,152 Q441* probably null Het
Fam186b T A 15: 99,283,892 M142L probably benign Het
Git2 G T 5: 114,769,698 C35* probably null Het
Gm21103 T G 14: 6,301,807 Q202P probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Hmcn2 C A 2: 31,360,896 T790K probably benign Het
Hspg2 T A 4: 137,552,116 L3114H probably damaging Het
Igkv3-10 A T 6: 70,572,981 Q37L possibly damaging Het
Kcp G T 6: 29,487,512 Y1106* probably null Het
Khsrp T C 17: 57,025,602 D226G possibly damaging Het
Klre1 T A 6: 129,583,166 W134R probably damaging Het
Lrrc66 A G 5: 73,629,977 I10T probably benign Het
Map4 T C 9: 109,978,870 M1T probably null Het
Met T A 6: 17,527,155 I535K probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mrpl41 A G 2: 24,974,456 L68P probably damaging Het
Mtmr4 T C 11: 87,600,613 W135R probably damaging Het
Mut T C 17: 40,952,839 V500A possibly damaging Het
Myh10 A G 11: 68,802,139 D1420G probably benign Het
Naglu A C 11: 101,072,230 D229A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Ncln G T 10: 81,487,849 Y517* probably null Het
Nr1h4 G A 10: 89,498,229 R100* probably null Het
Olfr173 G A 16: 58,797,408 T146M probably benign Het
P2rx5 A T 11: 73,160,648 T18S probably damaging Het
Pclo T C 5: 14,679,257 S2710P unknown Het
Pdhx A T 2: 103,073,314 F46I probably benign Het
Piezo2 A T 18: 63,145,110 L241* probably null Het
Pitpnm1 G A 19: 4,102,787 V65M probably damaging Het
Rgs3 A G 4: 62,690,487 D330G probably damaging Het
Scaf8 T C 17: 3,159,182 V60A unknown Het
Sema4c A G 1: 36,553,020 Y249H probably damaging Het
Spp2 T C 1: 88,407,328 Y27H probably damaging Het
Sugct T A 13: 17,644,787 I158F possibly damaging Het
Sympk A T 7: 19,054,092 I1178F probably benign Het
Tmppe T C 9: 114,404,968 Y112H probably benign Het
Trp53bp2 A G 1: 182,448,508 T187A Het
Tspoap1 A G 11: 87,774,697 S754G probably damaging Het
Vmn1r214 C T 13: 23,034,669 A111V probably benign Het
Vmn2r70 G C 7: 85,558,836 S811C probably benign Het
Zfp638 T C 6: 83,867,199 S15P unknown Het
Zfp763 A G 17: 33,018,795 S459P probably damaging Het
Other mutations in Aamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Aamp APN 1 74281436 unclassified probably benign
IGL02476:Aamp APN 1 74281524 unclassified probably benign
R0960:Aamp UTSW 1 74281145 missense possibly damaging 0.77
R1590:Aamp UTSW 1 74283211 missense probably damaging 1.00
R2138:Aamp UTSW 1 74283963 missense probably benign 0.00
R4112:Aamp UTSW 1 74281227 unclassified probably benign
R4223:Aamp UTSW 1 74281126 missense probably damaging 0.98
R5049:Aamp UTSW 1 74282539 missense probably damaging 1.00
R5283:Aamp UTSW 1 74284006 missense possibly damaging 0.49
R6353:Aamp UTSW 1 74280828 missense probably benign 0.37
R6526:Aamp UTSW 1 74284172 critical splice donor site probably null
R6683:Aamp UTSW 1 74282445 missense possibly damaging 0.76
R6884:Aamp UTSW 1 74284248 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGACCTCACTATCATCCGG -3'
(R):5'- ACCTTTAGTTTCTAGGCCTGGC -3'

Sequencing Primer
(F):5'- ATCATCCGGGCCCTCCATG -3'
(R):5'- GGGTTCCCTGACGCCTC -3'
Posted On2019-08-23