Incidental Mutation 'R7114:Tmeff2'
ID568560
Institutional Source Beutler Lab
Gene Symbol Tmeff2
Ensembl Gene ENSMUSG00000026109
Gene Nametransmembrane protein with EGF-like and two follistatin-like domains 2
Synonyms4832418D20Rik, 7630402F16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7114 (G1)
Quality Score168.009
Status Validated
Chromosome1
Chromosomal Location50900647-51187270 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 51185245 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081851]
Predicted Effect probably null
Transcript: ENSMUST00000081851
SMART Domains Protein: ENSMUSP00000080533
Gene: ENSMUSG00000026109

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
KAZAL 90 135 1.54e-14 SMART
KAZAL 181 227 6.05e-13 SMART
EGF 264 301 3.57e-2 SMART
transmembrane domain 319 341 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tomoregulin family of transmembrane proteins. This protein has been shown to function as both an oncogene and a tumor suppressor depending on the cellular context and may regulate prostate cancer cell invasion. Multiple soluble forms of this protein have been identified that arise from both an alternative splice variant and ectodomain shedding. Additionally, this gene has been found to be hypermethylated in multiple cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a reporter allele display slow postnatal weight gain, decreased white adipose tissue amount, and complete lethality at weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mdga1 C A 17: 29,842,842 probably null Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Tmeff2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Tmeff2 APN 1 51185450 missense probably damaging 1.00
IGL00707:Tmeff2 APN 1 51133053 splice site probably null
IGL01096:Tmeff2 APN 1 50930546 splice site probably benign
IGL01897:Tmeff2 APN 1 51132210 missense probably damaging 1.00
IGL02797:Tmeff2 APN 1 50928047 missense probably damaging 1.00
IGL03245:Tmeff2 APN 1 51181817 missense probably benign 0.30
R0454:Tmeff2 UTSW 1 50928075 missense possibly damaging 0.92
R0975:Tmeff2 UTSW 1 50938205 splice site probably benign
R1161:Tmeff2 UTSW 1 51181787 missense probably damaging 1.00
R1310:Tmeff2 UTSW 1 51181787 missense probably damaging 1.00
R1457:Tmeff2 UTSW 1 51181867 missense probably damaging 1.00
R3001:Tmeff2 UTSW 1 51181835 missense probably damaging 1.00
R3002:Tmeff2 UTSW 1 51181835 missense probably damaging 1.00
R3424:Tmeff2 UTSW 1 50979617 intron probably benign
R4807:Tmeff2 UTSW 1 50979387 missense probably benign 0.01
R4923:Tmeff2 UTSW 1 50930645 missense probably benign 0.29
R4977:Tmeff2 UTSW 1 50979556 nonsense probably null
R5176:Tmeff2 UTSW 1 51071541 nonsense probably null
R5220:Tmeff2 UTSW 1 50979317 missense probably benign 0.01
R5919:Tmeff2 UTSW 1 51132152 nonsense probably null
R5990:Tmeff2 UTSW 1 50979442 nonsense probably null
R6353:Tmeff2 UTSW 1 51181826 missense probably damaging 1.00
R6358:Tmeff2 UTSW 1 51133114 nonsense probably null
R6925:Tmeff2 UTSW 1 50928021 missense probably damaging 0.99
R7163:Tmeff2 UTSW 1 50938344 critical splice donor site probably null
R7332:Tmeff2 UTSW 1 50979440 missense unknown
R7762:Tmeff2 UTSW 1 50979416 missense probably benign 0.04
R8223:Tmeff2 UTSW 1 51133120 critical splice donor site probably null
R8260:Tmeff2 UTSW 1 50938319 missense probably damaging 0.97
R8301:Tmeff2 UTSW 1 51181837 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGCTGAGTCTGTTCATCACAC -3'
(R):5'- GTCTGAACTGTAGTGCCCTG -3'

Sequencing Primer
(F):5'- CTTCAGTTCTTGACAAAAGC -3'
(R):5'- AACTGTAGTGCCCTGTATTTTGC -3'
Posted On2019-08-23