Incidental Mutation 'R7167:Cux1'
ID568565
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Namecut-like homeobox 1
SynonymsCux-1, Cutl1, CDP, Cux
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R7167 (G1)
Quality Score125.008
Status Validated
Chromosome5
Chromosomal Location136248135-136567490 bp(-) (GRCm38)
Type of Mutationintron (4266 bp from exon)
DNA Base Change (assembly) G to A at 136310041 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176423] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]
Predicted Effect probably benign
Transcript: ENSMUST00000004097
SMART Domains Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
CUT 452 538 5.06e-39 SMART
low complexity region 602 608 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
CUT 841 929 3.31e-43 SMART
low complexity region 956 972 N/A INTRINSIC
low complexity region 990 1011 N/A INTRINSIC
CUT 1024 1110 3.78e-38 SMART
HOX 1150 1212 6.32e-15 SMART
low complexity region 1224 1239 N/A INTRINSIC
low complexity region 1317 1379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175918
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175975
SMART Domains Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 1 169 N/A INTRINSIC
low complexity region 235 251 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
CUT 358 444 5.06e-39 SMART
low complexity region 508 514 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
CUT 747 835 3.31e-43 SMART
low complexity region 862 878 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
CUT 930 1016 3.78e-38 SMART
HOX 1056 1118 6.32e-15 SMART
low complexity region 1130 1145 N/A INTRINSIC
low complexity region 1223 1285 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000175998
SMART Domains Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
Pfam:CASP_C 204 430 8.6e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176172
SMART Domains Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 99 354 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
CUT 543 629 5.06e-39 SMART
low complexity region 693 699 N/A INTRINSIC
low complexity region 711 733 N/A INTRINSIC
CUT 932 1020 3.31e-43 SMART
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1081 1102 N/A INTRINSIC
CUT 1115 1201 3.78e-38 SMART
HOX 1241 1303 6.32e-15 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1408 1470 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176216
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176423
SMART Domains Protein: ENSMUSP00000135036
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176486
SMART Domains Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
low complexity region 429 445 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
CUT 552 638 5.06e-39 SMART
Blast:CUT 641 840 3e-50 BLAST
CUT 919 1007 3.31e-43 SMART
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1068 1089 N/A INTRINSIC
CUT 1102 1188 3.78e-38 SMART
HOX 1228 1290 6.32e-15 SMART
low complexity region 1302 1317 N/A INTRINSIC
low complexity region 1395 1457 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176745
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176778
SMART Domains Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
low complexity region 78 86 N/A INTRINSIC
coiled coil region 195 448 N/A INTRINSIC
low complexity region 508 519 N/A INTRINSIC
CUT 535 621 5.06e-39 SMART
low complexity region 685 691 N/A INTRINSIC
low complexity region 703 725 N/A INTRINSIC
CUT 924 1012 3.31e-43 SMART
low complexity region 1039 1055 N/A INTRINSIC
low complexity region 1073 1094 N/A INTRINSIC
CUT 1107 1193 3.78e-38 SMART
HOX 1233 1295 6.32e-15 SMART
low complexity region 1307 1322 N/A INTRINSIC
low complexity region 1400 1462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177297
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 94% (65/69)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,647,971 V436A probably benign Het
Abcc5 T C 16: 20,405,501 T111A possibly damaging Het
Acsbg2 T A 17: 56,857,000 D203V probably benign Het
Alpk2 G T 18: 65,306,978 T448K probably benign Het
Arhgef2 A G 3: 88,643,872 N780S possibly damaging Het
Atxn2l T C 7: 126,499,222 N252S possibly damaging Het
Bmpr1b A T 3: 141,863,080 L163Q probably benign Het
Clca2 T C 3: 145,097,784 R100G probably benign Het
Col2a1 A G 15: 98,000,456 I79T unknown Het
Csmd1 A G 8: 15,926,524 V2898A probably benign Het
Cyp2u1 A G 3: 131,303,124 S2P probably benign Het
Daam1 C A 12: 71,988,904 H958N probably damaging Het
Dnah7a C T 1: 53,503,776 V2412I probably benign Het
Ergic2 T C 6: 148,206,635 R2G probably damaging Het
Fam159b A G 13: 104,863,658 V19A probably damaging Het
Fat2 T C 11: 55,285,001 T1629A possibly damaging Het
Ftl1 T A 7: 45,459,778 probably benign Het
Fut8 T C 12: 77,448,632 V332A possibly damaging Het
Gm28363 T C 1: 117,727,389 S113P probably damaging Het
Gm6502 G A 5: 94,317,125 A457T possibly damaging Het
Hfe A T 13: 23,708,069 V104E probably damaging Het
Ifih1 A T 2: 62,598,896 N899K probably benign Het
Krt75 A G 15: 101,568,315 S380P possibly damaging Het
Meiob T G 17: 24,836,445 F409V probably damaging Het
Mkrn2os A T 6: 115,585,513 I163N probably damaging Het
Nanos1 G T 19: 60,756,608 G115W probably damaging Het
Naprt C T 15: 75,892,612 A276T probably damaging Het
Oas1e G T 5: 120,795,422 T26N probably benign Het
Olfr1179 A G 2: 88,402,208 V242A possibly damaging Het
Olfr1279 T C 2: 111,306,448 M81T probably benign Het
Olfr355 T C 2: 36,927,521 I198V probably benign Het
Olfr53 T A 7: 140,652,553 C191* probably null Het
Olfr766-ps1 T G 10: 129,063,272 Q245P probably damaging Het
Olfr792 T C 10: 129,540,738 L67P possibly damaging Het
Olfr967 T C 9: 39,750,569 F61S probably damaging Het
Oog2 T G 4: 144,195,175 D218E probably benign Het
Optn T C 2: 5,042,483 N207S probably benign Het
Oxnad1 G T 14: 32,101,019 E236* probably null Het
Pcdha3 G A 18: 36,946,993 A263T probably damaging Het
Pex13 A T 11: 23,655,472 W253R possibly damaging Het
Pip5k1b T A 19: 24,397,069 E49D probably benign Het
Plau C A 14: 20,839,450 F194L possibly damaging Het
Ppm1n A G 7: 19,279,741 L95S probably damaging Het
Radil G T 5: 142,485,505 probably null Het
Ralgapa2 C T 2: 146,348,454 M1266I probably benign Het
Reln A T 5: 21,942,620 L2444Q probably damaging Het
Rims2 T C 15: 39,437,077 V260A probably benign Het
Rnase2b T A 14: 51,162,765 V101E probably damaging Het
Rtp3 T A 9: 110,986,704 T198S probably benign Het
Smad3 T A 9: 63,666,153 D201V probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Spata7 T G 12: 98,664,296 F371C probably damaging Het
Stag1 T G 9: 100,945,889 N990K probably benign Het
Tbx18 C T 9: 87,707,830 A352T probably damaging Het
Thada C T 17: 84,230,963 R1539Q probably benign Het
Thrap3 A C 4: 126,185,127 probably benign Het
Tnks G A 8: 34,849,304 T887M probably damaging Het
Trap1 A C 16: 4,052,928 V393G probably damaging Het
Trpm4 A G 7: 45,327,719 probably null Het
Trrap G T 5: 144,839,614 G3007C probably benign Het
U2surp A T 9: 95,481,673 N611K probably damaging Het
Usp12 A G 5: 146,768,935 probably null Het
Vmn1r200 A G 13: 22,395,317 T97A possibly damaging Het
Vmn2r110 C T 17: 20,574,179 V743I probably benign Het
Vps50 C T 6: 3,600,256 T905M probably damaging Het
Wdr48 T A 9: 119,907,789 probably null Het
Zfp446 C T 7: 12,978,122 probably benign Het
Zfr T C 15: 12,180,929 S1012P probably benign Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136326796 missense probably damaging 1.00
IGL00966:Cux1 APN 5 136311491 intron probably benign
IGL01129:Cux1 APN 5 136304718 intron probably benign
IGL01885:Cux1 APN 5 136308447 missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136275125 missense probably benign 0.04
IGL02259:Cux1 APN 5 136326833 missense probably damaging 1.00
IGL02666:Cux1 APN 5 136275315 nonsense probably null
IGL02826:Cux1 APN 5 136308003 missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136565525 intron probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0057:Cux1 UTSW 5 136256282 missense probably damaging 1.00
R0149:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0295:Cux1 UTSW 5 136313212 missense probably benign 0.04
R0361:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0533:Cux1 UTSW 5 136307859 missense probably damaging 1.00
R0630:Cux1 UTSW 5 136286835 missense probably damaging 1.00
R0801:Cux1 UTSW 5 136326929 missense probably damaging 0.97
R0884:Cux1 UTSW 5 136307835 missense probably damaging 1.00
R0976:Cux1 UTSW 5 136313290 missense probably damaging 1.00
R1073:Cux1 UTSW 5 136252541 critical splice donor site probably null
R1222:Cux1 UTSW 5 136275149 missense probably benign 0.18
R1518:Cux1 UTSW 5 136308279 missense probably benign 0.29
R1686:Cux1 UTSW 5 136275381 nonsense probably null
R1687:Cux1 UTSW 5 136312669 missense probably damaging 1.00
R1758:Cux1 UTSW 5 136392322 missense probably damaging 1.00
R1797:Cux1 UTSW 5 136275315 missense probably benign 0.22
R1919:Cux1 UTSW 5 136363319 nonsense probably null
R2051:Cux1 UTSW 5 136332658 missense probably damaging 1.00
R2339:Cux1 UTSW 5 136287008 missense probably damaging 1.00
R3438:Cux1 UTSW 5 136311560 missense probably damaging 0.97
R3713:Cux1 UTSW 5 136565543 intron probably benign
R3800:Cux1 UTSW 5 136316033 missense probably damaging 1.00
R3964:Cux1 UTSW 5 136282942 missense probably damaging 1.00
R4135:Cux1 UTSW 5 136307896 missense probably damaging 1.00
R4198:Cux1 UTSW 5 136286848 missense probably damaging 1.00
R4467:Cux1 UTSW 5 136312722 missense probably damaging 1.00
R4498:Cux1 UTSW 5 136312993 missense probably damaging 1.00
R4622:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4623:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4651:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4652:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4658:Cux1 UTSW 5 136250594 missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136286799 missense probably damaging 1.00
R4704:Cux1 UTSW 5 136249201 missense probably benign 0.01
R4867:Cux1 UTSW 5 136274961 intron probably benign
R4965:Cux1 UTSW 5 136311556 missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136313200 missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136565441 intron probably benign
R5226:Cux1 UTSW 5 136370173 missense probably benign 0.01
R5252:Cux1 UTSW 5 136308297 missense probably damaging 0.98
R5266:Cux1 UTSW 5 136312694 missense probably damaging 1.00
R5399:Cux1 UTSW 5 136252604 missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136275317 missense probably benign 0.13
R5609:Cux1 UTSW 5 136392320 missense probably damaging 1.00
R5681:Cux1 UTSW 5 136308184 missense probably damaging 1.00
R5993:Cux1 UTSW 5 136363271 missense probably benign 0.00
R6049:Cux1 UTSW 5 136332710 missense probably damaging 1.00
R6290:Cux1 UTSW 5 136311558 missense probably damaging 0.99
R6310:Cux1 UTSW 5 136275164 missense probably benign 0.10
R6351:Cux1 UTSW 5 136309792 missense probably damaging 1.00
R6531:Cux1 UTSW 5 136275119 missense probably benign 0.03
R6590:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6663:Cux1 UTSW 5 136485847 missense probably damaging 1.00
R6690:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6777:Cux1 UTSW 5 136565568 intron probably benign
R6786:Cux1 UTSW 5 136567231 missense probably damaging 1.00
R6817:Cux1 UTSW 5 136373173 intron probably null
R6989:Cux1 UTSW 5 136279648 nonsense probably null
R7011:Cux1 UTSW 5 136360033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGATGACATCACAGCCAG -3'
(R):5'- TCAGATGGTAAGAAAGCCTATTCTG -3'

Sequencing Primer
(F):5'- TCACAGCCAGATCTCAAGTGG -3'
(R):5'- CAGGGCTATACAGAGAAACC -3'
Posted On2019-08-23