Incidental Mutation 'R7114:Mdga1'
ID568566
Institutional Source Beutler Lab
Gene Symbol Mdga1
Ensembl Gene ENSMUSG00000043557
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock #R7114 (G1)
Quality Score161.009
Status Validated
Chromosome17
Chromosomal Location29827956-29970087 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) C to A at 29842842 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073556] [ENSMUST00000167190] [ENSMUST00000168044] [ENSMUST00000171691]
Predicted Effect probably null
Transcript: ENSMUST00000073556
SMART Domains Protein: ENSMUSP00000073246
Gene: ENSMUSG00000043557

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 741 911 1.02e-52 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167190
SMART Domains Protein: ENSMUSP00000130395
Gene: ENSMUSG00000043557

DomainStartEndE-ValueType
low complexity region 236 246 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
IGc2 325 389 1.62e-12 SMART
IG 416 510 3.2e-2 SMART
IGc2 527 589 6.25e-14 SMART
IGc2 622 696 3.54e-4 SMART
IGc2 728 795 6.55e-8 SMART
IGc2 825 897 9.49e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168044
SMART Domains Protein: ENSMUSP00000126571
Gene: ENSMUSG00000043557

DomainStartEndE-ValueType
Pfam:MAM 47 186 3.1e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171691
SMART Domains Protein: ENSMUSP00000126529
Gene: ENSMUSG00000043557

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 749 919 3.61e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that is expressed predominantly in the developing nervous system. In addition to possessing several cell adhesion molecule-like domains, the mature protein has six Ig-like domains, a single fibronectin type III domain, a MAM domain and a C-terminal GPI-anchoring site. Studies in other mammals suggest this protein plays a role in cell adhesion, migration, and axon guidance and, in the developing brain, neuronal migration. In humans, this gene is associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuronal migration during corticogenesis that is resolved by P7 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C T 11: 120,009,619 A1291T probably benign Het
Anks1b G A 10: 90,307,698 R523Q probably damaging Het
Arhgap12 T A 18: 6,028,056 I690F probably damaging Het
Caln1 T C 5: 130,839,283 V220A possibly damaging Het
Cd79b T A 11: 106,311,887 T263S probably damaging Het
Cep290 A T 10: 100,543,358 K67N probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Col25a1 A G 3: 130,595,675 I636V probably benign Het
Col9a3 C T 2: 180,603,797 P154S unknown Het
Cyp3a11 T A 5: 145,858,783 M453L probably benign Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Eno1b T C 18: 48,047,493 V246A possibly damaging Het
Eogt T C 6: 97,116,004 Y404C probably damaging Het
Ephx3 T A 17: 32,185,032 E380V possibly damaging Het
Fancl T C 11: 26,407,615 L114P probably damaging Het
Flad1 C T 3: 89,407,530 G287S probably benign Het
Gcm1 G T 9: 78,059,779 K93N probably damaging Het
Golga3 T A 5: 110,202,712 D704E probably benign Het
Grb14 A C 2: 64,916,853 I451S probably damaging Het
Gtf3c3 T C 1: 54,423,507 N366D probably benign Het
Hecw1 A T 13: 14,311,771 H376Q probably benign Het
Helb A T 10: 120,105,256 V509E probably benign Het
Hephl1 C T 9: 15,069,815 E774K probably damaging Het
Hkdc1 T C 10: 62,393,843 E685G probably damaging Het
Igfn1 T C 1: 135,966,781 T2016A probably benign Het
Igkv5-43 T G 6: 69,823,531 Q57H probably damaging Het
Lamc3 T A 2: 31,930,645 V1224E probably damaging Het
Lgals3bp C T 11: 118,393,483 W423* probably null Het
Mcm9 G A 10: 53,538,573 T137I possibly damaging Het
Mocos C T 18: 24,666,515 P269S probably damaging Het
Naa40 A G 19: 7,229,957 V134A probably damaging Het
Neb G A 2: 52,192,559 L5680F probably damaging Het
Nedd9 A G 13: 41,338,623 V137A probably benign Het
Nup133 T C 8: 123,915,373 I784V probably benign Het
Nup214 T C 2: 32,025,244 S1147P possibly damaging Het
Olfr248 A T 1: 174,391,239 M57L probably damaging Het
Olfr945 G T 9: 39,258,601 Q24K possibly damaging Het
Plcb4 T A 2: 135,982,123 probably null Het
Pomt1 C T 2: 32,253,836 T671I probably benign Het
Pomt2 G T 12: 87,110,376 P723H probably damaging Het
Prpf8 T A 11: 75,503,355 Y1741* probably null Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Slc36a4 T C 9: 15,721,954 F95L probably benign Het
Smn1 C T 13: 100,131,140 P225S probably benign Het
Snrpa A T 7: 27,191,749 I99N probably benign Het
Tgm5 G T 2: 121,048,496 Y588* probably null Het
Tmeff2 T A 1: 51,185,245 probably null Het
Tmem120b T C 5: 123,116,678 F314S probably damaging Het
Trim43b C T 9: 89,085,608 R325H probably benign Het
Vmn1r26 C T 6: 58,008,770 A145T probably benign Het
Wdfy4 T C 14: 32,971,574 probably null Het
Wnt5a C A 14: 28,522,756 T320K probably damaging Het
Wrn AGCAGGTAATACATACCG AG 8: 33,285,121 probably null Het
Zfp398 T C 6: 47,865,976 S321P probably benign Het
Zfp959 T A 17: 55,898,501 C513S possibly damaging Het
Zfr2 A G 10: 81,244,725 D411G probably damaging Het
Zkscan5 T A 5: 145,211,178 probably benign Het
Other mutations in Mdga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Mdga1 APN 17 29843127 missense possibly damaging 0.50
IGL01637:Mdga1 APN 17 29839871 missense probably damaging 1.00
IGL02130:Mdga1 APN 17 29857669 missense possibly damaging 0.96
IGL02596:Mdga1 APN 17 29832405 splice site probably benign
IGL03258:Mdga1 APN 17 29839913 missense probably damaging 1.00
R0184:Mdga1 UTSW 17 29852442 missense probably damaging 1.00
R0366:Mdga1 UTSW 17 29857708 missense possibly damaging 0.85
R1017:Mdga1 UTSW 17 29850548 missense probably damaging 0.98
R1520:Mdga1 UTSW 17 29846519 missense probably benign 0.12
R1545:Mdga1 UTSW 17 29842902 missense probably damaging 1.00
R1549:Mdga1 UTSW 17 29837998 missense probably damaging 1.00
R1671:Mdga1 UTSW 17 29850629 missense probably damaging 1.00
R1875:Mdga1 UTSW 17 29852607 missense probably damaging 1.00
R1893:Mdga1 UTSW 17 29849226 missense probably damaging 1.00
R1958:Mdga1 UTSW 17 29840888 missense probably damaging 1.00
R1983:Mdga1 UTSW 17 29850605 missense probably damaging 1.00
R2014:Mdga1 UTSW 17 29849313 missense probably damaging 1.00
R2894:Mdga1 UTSW 17 29852504 missense probably damaging 1.00
R2964:Mdga1 UTSW 17 29852468 missense probably damaging 1.00
R3813:Mdga1 UTSW 17 29838479 missense probably damaging 1.00
R3938:Mdga1 UTSW 17 29857622 missense probably damaging 1.00
R3982:Mdga1 UTSW 17 29931264 missense unknown
R4063:Mdga1 UTSW 17 29838031 missense probably damaging 1.00
R4157:Mdga1 UTSW 17 29833343 missense probably benign 0.32
R4183:Mdga1 UTSW 17 29969990 missense unknown
R4392:Mdga1 UTSW 17 29850656 missense probably damaging 1.00
R4393:Mdga1 UTSW 17 29850517 missense probably damaging 1.00
R4396:Mdga1 UTSW 17 29850517 missense probably damaging 1.00
R4806:Mdga1 UTSW 17 29842154 missense probably benign 0.20
R4829:Mdga1 UTSW 17 29846369 missense possibly damaging 0.91
R4923:Mdga1 UTSW 17 29838078 missense probably damaging 0.99
R4932:Mdga1 UTSW 17 29857606 missense probably damaging 1.00
R5015:Mdga1 UTSW 17 29839873 missense possibly damaging 0.71
R5076:Mdga1 UTSW 17 29850554 missense possibly damaging 0.93
R5141:Mdga1 UTSW 17 29852493 missense probably benign 0.43
R5180:Mdga1 UTSW 17 29857736 splice site probably benign
R5590:Mdga1 UTSW 17 29839867 missense probably damaging 1.00
R5747:Mdga1 UTSW 17 29850551 missense probably benign 0.11
R5748:Mdga1 UTSW 17 29850551 missense probably benign 0.11
R6207:Mdga1 UTSW 17 29838517 missense probably damaging 1.00
R6826:Mdga1 UTSW 17 29970026 missense unknown
R6831:Mdga1 UTSW 17 29887516 nonsense probably null
R7147:Mdga1 UTSW 17 29846521 nonsense probably null
R7273:Mdga1 UTSW 17 29969938 missense unknown
R7413:Mdga1 UTSW 17 29850673 missense probably damaging 1.00
R7637:Mdga1 UTSW 17 29832379 missense probably benign 0.00
R7797:Mdga1 UTSW 17 29842840 splice site probably null
R7812:Mdga1 UTSW 17 29843141 missense probably benign 0.02
R7838:Mdga1 UTSW 17 29839822 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAGACCGCAAAGCCTGTGAG -3'
(R):5'- AGTGCGAAGTTCGTGGCAAG -3'

Sequencing Primer
(F):5'- CAAAGCCTGTGAGCTTGGAGC -3'
(R):5'- CTCCAGTGCTATGGTCTCGG -3'
Posted On2019-08-23