Mutagenetix > Incidental Mutations

Incidental Mutation 'R7099:Nbeal2'

568573

Institutional Source

Beutler Lab

Gene Symbol

Nbeal2

Ensembl Gene

ENSMUSG00000056724

Gene Name

neurobeachin-like 2

Synonyms

1110014F23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.339) question?

Stock #

R7099 (G1)

Quality Score

103.008

Status

Validated

Chromosome

Chromosomal Location

110624789-110654161 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 110645438 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000133191] [ENSMUST00000149089] [ENSMUST00000167320] [ENSMUST00000196488]

Predicted Effect

probably null
Transcript: ENSMUST00000133191

SMART Domains

Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
Pfam:Laminin_G_3	578	818	5.9e-8	PFAM
low complexity region	1014	1028	N/A	INTRINSIC
low complexity region	1128	1136	N/A	INTRINSIC
low complexity region	1149	1163	N/A	INTRINSIC
low complexity region	1359	1375	N/A	INTRINSIC
low complexity region	1515	1530	N/A	INTRINSIC
low complexity region	1621	1647	N/A	INTRINSIC
low complexity region	1875	1904	N/A	INTRINSIC
Pfam:PH_BEACH	1908	2002	6.2e-28	PFAM
Beach	2054	2334	5.2e-205	SMART
WD40	2432	2477	1.03e1	SMART
WD40	2480	2519	6.19e-5	SMART
WD40	2531	2570	1.02e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149089

SMART Domains

Protein: ENSMUSP00000119254
Gene: ENSMUSG00000056724

Domain	Start	End	E-Value	Type
low complexity region	49	77	N/A	INTRINSIC
low complexity region	185	194	N/A	INTRINSIC
low complexity region	220	231	N/A	INTRINSIC
low complexity region	480	488	N/A	INTRINSIC
low complexity region	493	508	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000167320

SMART Domains

Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	763	775	N/A	INTRINSIC
Pfam:DUF4704	872	1148	9.2e-32	PFAM
low complexity region	1149	1163	N/A	INTRINSIC
low complexity region	1366	1382	N/A	INTRINSIC
low complexity region	1522	1537	N/A	INTRINSIC
Pfam:DUF4800	1590	1856	1.5e-112	PFAM
low complexity region	1882	1911	N/A	INTRINSIC
Pfam:PH_BEACH	1922	2009	3.1e-21	PFAM
Beach	2061	2341	5.2e-205	SMART
WD40	2439	2484	1.03e1	SMART
WD40	2487	2526	6.19e-5	SMART
WD40	2538	2577	1.02e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000196488

SMART Domains

Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	487	495	N/A	INTRINSIC
low complexity region	500	515	N/A	INTRINSIC
Pfam:Laminin_G_3	551	791	5.3e-6	PFAM
low complexity region	987	1001	N/A	INTRINSIC
low complexity region	1101	1109	N/A	INTRINSIC
low complexity region	1122	1136	N/A	INTRINSIC
low complexity region	1332	1348	N/A	INTRINSIC
low complexity region	1488	1503	N/A	INTRINSIC
low complexity region	1594	1620	N/A	INTRINSIC
low complexity region	1848	1877	N/A	INTRINSIC
Pfam:PH_BEACH	1881	1975	3.1e-25	PFAM
Beach	2027	2307	3.8e-209	SMART
WD40	2405	2450	6.3e-2	SMART
WD40	2453	2492	3.8e-7	SMART
WD40	2504	2543	6.5e-8	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice exhibit megakaryocyte and platelet abnormalities resulting in impaired arterial thrombus formation and protection from infarction following cerebral ischemia. Wound repair is impaired. These abnormalities result in a bleeding disorder similiar to Gray Platelet Syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930453N24Rik	C	T	16: 64,770,788	A26T	probably benign	Het
Acly	T	C	11: 100,492,291		probably null	Het
Adam29	A	C	8: 55,871,404	L672V	probably benign	Het
Adgrf1	T	C	17: 43,310,602	S577P	probably benign	Het
Ankar	T	C	1: 72,643,293	K1371R	probably damaging	Het
Arid5b	T	C	10: 68,098,179	D631G	probably damaging	Het
Brpf3	T	C	17: 28,806,637	V228A	probably benign	Het
C3	T	C	17: 57,206,276	D1457G	probably benign	Het
Calr4	A	T	4: 109,242,229	N143I	probably benign	Het
Catsperd	T	G	17: 56,628,811		probably null	Het
Cobl	T	A	11: 12,296,540	H154L		Het
Cryzl2	G	A	1: 157,488,584		probably benign	Het
Dennd1c	A	G	17: 57,067,915		probably null	Het
Dnah8	A	T	17: 30,704,724	D1222V	possibly damaging	Het
Errfi1	T	C	4: 150,866,768	S218P	probably benign	Het
Fbxw27	G	T	9: 109,770,155	T398N	probably damaging	Het
Fhod3	A	G	18: 25,090,162	D855G	probably benign	Het
Flii	A	G	11: 60,720,655	V410A	probably benign	Het
Fsip2	C	A	2: 82,987,624	P4567Q	probably benign	Het
Fxyd1	T	G	7: 31,053,033	Q66H	probably damaging	Het
Gdi1	G	A	X: 74,306,855	R55H	probably benign	Het
Gramd3	C	T	18: 56,491,945	T370I	probably benign	Het
Kdr	A	G	5: 75,944,333	V1079A	probably damaging	Het
Lmx1a	G	A	1: 167,830,546	G166D	probably damaging	Het
Lrrfip2	A	G	9: 111,173,108	R92G	probably benign	Het
Map1a	T	A	2: 121,300,517	S605T	probably benign	Het
Megf8	A	T	7: 25,346,520	D1496V	probably damaging	Het
Mgam	T	C	6: 40,661,716	V461A	probably benign	Het
Muc6	AGGCGCAGAAACCCTGGC	AGGC	7: 141,634,450		probably null	Het
Nav3	T	C	10: 109,703,334	T2069A	probably benign	Het
Ndst1	A	G	18: 60,695,500	F661L	possibly damaging	Het
Neu3	G	A	7: 99,813,820	T232M	possibly damaging	Het
Nf1	T	C	11: 79,570,330	S741P	probably benign	Het
Nr5a1	G	T	2: 38,694,136	L424M	probably damaging	Het
Nuf2	G	A	1: 169,506,072	T345M	probably benign	Het
Olfr1301	A	T	2: 111,755,076	T276S	probably benign	Het
Olfr1426	A	G	19: 12,088,166	F209L	possibly damaging	Het
Olfr212	T	A	6: 116,516,760	*328R	probably null	Het
Olfr952	G	A	9: 39,426,303	T256I	probably benign	Het
Otud7a	A	G	7: 63,757,455	E502G	possibly damaging	Het
Otulin	A	G	15: 27,608,746	L237S	probably damaging	Het
Pias1	A	G	9: 62,881,145	M79T		Het
Prom2	T	C	2: 127,539,778	E206G	probably benign	Het
Scarb1	A	T	5: 125,304,350	N43K	probably damaging	Het
Sdad1	A	G	5: 92,293,973	V365A	possibly damaging	Het
Sdk2	T	C	11: 113,834,905	T1173A	probably damaging	Het
Sidt1	A	G	16: 44,243,497	S803P	probably damaging	Het
Slc45a1	A	T	4: 150,629,573	D738E	probably benign	Het
Slc4a7	T	A	14: 14,733,750	H53Q	probably damaging	Het
Spata22	T	C	11: 73,340,399	F160L	probably benign	Het
Stag1	G	A	9: 100,944,826	V949I	probably benign	Het
Syne1	T	C	10: 5,123,744	S1200G	probably benign	Het
Tbc1d9	A	G	8: 83,254,891	E729G	probably damaging	Het
Tcaf2	C	T	6: 42,630,341	M226I	probably benign	Het
Tep1	T	C	14: 50,844,487		probably null	Het
Tigd2	C	A	6: 59,210,181	T11K	probably damaging	Het
Trappc9	A	G	15: 72,693,619	V941A	probably benign	Het
Ugt2b37	A	G	5: 87,240,989	M455T	probably benign	Het
Usp42	A	T	5: 143,726,645	S95T	probably damaging	Het
Usp44	T	C	10: 93,850,187	I488T	possibly damaging	Het
Vmn1r73	T	C	7: 11,756,393	I46T	probably damaging	Het
Vmn2r34	A	T	7: 7,672,541	I616N	probably damaging	Het
Zfp352	A	G	4: 90,224,880	K419R	probably benign	Het
Zfp595	T	A	13: 67,317,647	H187L	probably damaging	Het
Zfp804b	A	T	5: 6,772,161	S301T	probably benign	Het
Zzef1	T	C	11: 72,872,649	V1374A	possibly damaging	Het

Other mutations in Nbeal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Nbeal2	APN	9	110635869	missense	probably damaging	1.00
IGL00784:Nbeal2	APN	9	110629763	splice site	probably benign
IGL00826:Nbeal2	APN	9	110626903	missense	probably benign
IGL00885:Nbeal2	APN	9	110638661	missense	probably damaging	1.00
IGL01348:Nbeal2	APN	9	110629146	missense	probably damaging	0.99
IGL01511:Nbeal2	APN	9	110629234	missense	probably damaging	1.00
IGL01571:Nbeal2	APN	9	110632758	missense	possibly damaging	0.63
IGL01612:Nbeal2	APN	9	110644678	missense	probably damaging	1.00
IGL01924:Nbeal2	APN	9	110631414	missense	probably benign	0.23
IGL02056:Nbeal2	APN	9	110627324	missense	probably benign	0.17
IGL02481:Nbeal2	APN	9	110625995	nonsense	probably null
IGL02483:Nbeal2	APN	9	110625995	nonsense	probably null
IGL02502:Nbeal2	APN	9	110633768	missense	probably damaging	1.00
IGL02631:Nbeal2	APN	9	110630208	missense	probably damaging	0.99
IGL02637:Nbeal2	APN	9	110625977	missense	possibly damaging	0.62
IGL02727:Nbeal2	APN	9	110639285	splice site	probably benign
IGL02887:Nbeal2	APN	9	110628276	missense	probably damaging	1.00
IGL02896:Nbeal2	APN	9	110639292	critical splice donor site	probably null
IGL03110:Nbeal2	APN	9	110631433	missense	probably damaging	1.00
legion	UTSW	9	110629179	missense	probably damaging	1.00
litigious	UTSW	9	110628195	missense	probably damaging	1.00
mall	UTSW	9	110632886	missense	probably damaging	1.00
Mollusca	UTSW	9	110645438	intron	probably null
schleuter	UTSW	9	110628744	missense	possibly damaging	0.69
shellfish	UTSW	9	110628720	missense	probably damaging	1.00
F5770:Nbeal2	UTSW	9	110637937	missense	possibly damaging	0.65
R0032:Nbeal2	UTSW	9	110637868	splice site	probably benign
R0084:Nbeal2	UTSW	9	110643710	critical splice donor site	probably null
R0147:Nbeal2	UTSW	9	110642143	nonsense	probably null
R0294:Nbeal2	UTSW	9	110632859	missense	probably damaging	1.00
R0310:Nbeal2	UTSW	9	110638163	missense	probably damaging	1.00
R0494:Nbeal2	UTSW	9	110627187	missense	probably damaging	1.00
R0550:Nbeal2	UTSW	9	110642158	missense	probably benign	0.01
R0630:Nbeal2	UTSW	9	110636034	splice site	probably benign
R0762:Nbeal2	UTSW	9	110643808	splice site	probably benign
R0862:Nbeal2	UTSW	9	110628195	missense	probably damaging	1.00
R0864:Nbeal2	UTSW	9	110628195	missense	probably damaging	1.00
R1225:Nbeal2	UTSW	9	110632886	missense	probably damaging	1.00
R1240:Nbeal2	UTSW	9	110627108	missense	probably damaging	0.98
R1450:Nbeal2	UTSW	9	110633672	splice site	probably benign
R1519:Nbeal2	UTSW	9	110636305	missense	probably damaging	1.00
R1655:Nbeal2	UTSW	9	110632872	missense	probably damaging	1.00
R1668:Nbeal2	UTSW	9	110638893	missense	probably damaging	1.00
R1705:Nbeal2	UTSW	9	110625196	missense	probably damaging	1.00
R1784:Nbeal2	UTSW	9	110630857	nonsense	probably null
R1834:Nbeal2	UTSW	9	110627129	missense	probably damaging	1.00
R1997:Nbeal2	UTSW	9	110632198	missense	probably damaging	1.00
R2013:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2014:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2055:Nbeal2	UTSW	9	110635307	missense	possibly damaging	0.92
R2086:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2113:Nbeal2	UTSW	9	110625406	missense	probably damaging	1.00
R2167:Nbeal2	UTSW	9	110638308	missense	probably damaging	1.00
R2201:Nbeal2	UTSW	9	110630250	missense	probably benign	0.16
R2309:Nbeal2	UTSW	9	110626570	missense	probably damaging	1.00
R2378:Nbeal2	UTSW	9	110630808	missense	probably damaging	0.99
R2945:Nbeal2	UTSW	9	110628068	missense	possibly damaging	0.82
R3052:Nbeal2	UTSW	9	110633085	missense	possibly damaging	0.93
R3076:Nbeal2	UTSW	9	110631700	missense	probably damaging	1.00
R3176:Nbeal2	UTSW	9	110636887	splice site	probably benign
R3974:Nbeal2	UTSW	9	110633846	missense	probably damaging	1.00
R4183:Nbeal2	UTSW	9	110636675	missense	probably benign
R4342:Nbeal2	UTSW	9	110631793	intron	probably benign
R4654:Nbeal2	UTSW	9	110632004	missense	probably damaging	1.00
R4707:Nbeal2	UTSW	9	110632055	missense	probably benign	0.10
R4822:Nbeal2	UTSW	9	110636315	missense	possibly damaging	0.82
R4854:Nbeal2	UTSW	9	110631396	missense	probably damaging	1.00
R4860:Nbeal2	UTSW	9	110635194	missense	probably benign	0.00
R4860:Nbeal2	UTSW	9	110635194	missense	probably benign	0.00
R4990:Nbeal2	UTSW	9	110634803	missense	probably benign	0.10
R4991:Nbeal2	UTSW	9	110638767	missense	probably damaging	1.00
R5021:Nbeal2	UTSW	9	110637463	missense	probably damaging	0.99
R5057:Nbeal2	UTSW	9	110631005	missense	probably damaging	1.00
R5092:Nbeal2	UTSW	9	110626728	splice site	probably null
R5161:Nbeal2	UTSW	9	110629868	missense	probably benign
R5202:Nbeal2	UTSW	9	110644666	missense	probably damaging	0.99
R5217:Nbeal2	UTSW	9	110632090	missense	possibly damaging	0.56
R5408:Nbeal2	UTSW	9	110637520	missense	possibly damaging	0.91
R5540:Nbeal2	UTSW	9	110631733	missense	probably damaging	1.00
R5866:Nbeal2	UTSW	9	110631492	missense	probably damaging	1.00
R5925:Nbeal2	UTSW	9	110629880	missense	probably benign	0.00
R6057:Nbeal2	UTSW	9	110641877	missense	possibly damaging	0.81
R6180:Nbeal2	UTSW	9	110625147	missense	probably damaging	1.00
R6191:Nbeal2	UTSW	9	110627990	critical splice donor site	probably null
R6232:Nbeal2	UTSW	9	110638734	missense	probably damaging	1.00
R6372:Nbeal2	UTSW	9	110628744	missense	possibly damaging	0.69
R6423:Nbeal2	UTSW	9	110625994	missense	probably damaging	1.00
R6543:Nbeal2	UTSW	9	110644458	missense	probably benign
R6648:Nbeal2	UTSW	9	110637642	missense	probably damaging	1.00
R6722:Nbeal2	UTSW	9	110632992	missense	probably damaging	1.00
R6738:Nbeal2	UTSW	9	110636905	missense	possibly damaging	0.93
R6916:Nbeal2	UTSW	9	110626108	missense	probably damaging	1.00
R6935:Nbeal2	UTSW	9	110639391	missense	probably damaging	1.00
R7022:Nbeal2	UTSW	9	110638618	missense	probably damaging	1.00
R7023:Nbeal2	UTSW	9	110638618	missense	probably damaging	1.00
R7050:Nbeal2	UTSW	9	110628720	missense	probably damaging	1.00
R7072:Nbeal2	UTSW	9	110626051	missense	probably benign	0.01
R7073:Nbeal2	UTSW	9	110626109	missense	probably damaging	0.99
R7354:Nbeal2	UTSW	9	110629179	missense	probably damaging	1.00
R7394:Nbeal2	UTSW	9	110630189	critical splice donor site	probably null
R7397:Nbeal2	UTSW	9	110628032	missense	possibly damaging	0.78
R7552:Nbeal2	UTSW	9	110653917	missense	probably benign	0.16
R7619:Nbeal2	UTSW	9	110625818	missense	probably benign	0.19
R7821:Nbeal2	UTSW	9	110630252	missense	probably damaging	1.00
V7583:Nbeal2	UTSW	9	110637937	missense	possibly damaging	0.65
X0017:Nbeal2	UTSW	9	110644278	missense	probably benign	0.02
X0065:Nbeal2	UTSW	9	110644413	splice site	probably benign
Z1088:Nbeal2	UTSW	9	110632372	missense	possibly damaging	0.51

Predicted Primers

PCR Primer
(F):5'- TGAAACCTCTACCCACGTTTGC -3'
(R):5'- GGCTTGAGGTATTAAGCCACG -3'

Sequencing Primer
(F):5'- ACGTTTGCTGTTTACCTGGAC -3'
(R):5'- CTTGAGGTATTAAGCCACGTCAGG -3'

Posted On

2019-08-26