Incidental Mutation 'R7121:Chmp5'
ID568578
Institutional Source Beutler Lab
Gene Symbol Chmp5
Ensembl Gene ENSMUSG00000028419
Gene Namecharged multivesicular body protein 5
Synonyms2210412K09Rik, chromatin modifying protein 5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7121 (G1)
Quality Score167.009
Status Validated
Chromosome4
Chromosomal Location40948407-40965303 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 40952217 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030125] [ENSMUST00000030128] [ENSMUST00000108089] [ENSMUST00000191273] [ENSMUST00000215842]
Predicted Effect probably benign
Transcript: ENSMUST00000030125
SMART Domains Protein: ENSMUSP00000030125
Gene: ENSMUSG00000028416

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 69 79 N/A INTRINSIC
low complexity region 117 134 N/A INTRINSIC
low complexity region 140 151 N/A INTRINSIC
UBQ 154 230 9.52e-11 SMART
low complexity region 235 248 N/A INTRINSIC
BAG 256 336 1.92e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000030128
SMART Domains Protein: ENSMUSP00000030128
Gene: ENSMUSG00000028419

DomainStartEndE-ValueType
Pfam:Snf7 12 197 5.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108089
SMART Domains Protein: ENSMUSP00000103724
Gene: ENSMUSG00000028416

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
UBQ 18 94 9.52e-11 SMART
low complexity region 99 112 N/A INTRINSIC
BAG 120 200 1.92e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191273
SMART Domains Protein: ENSMUSP00000139864
Gene: ENSMUSG00000028416

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
UBQ 18 94 9.52e-11 SMART
low complexity region 99 112 N/A INTRINSIC
BAG 120 200 1.92e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215842
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CHMP5 belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, cardia bifida, impaired chorioallantoic fusion, abnormal somite and neural plate devlopment, accumulation of multivesicular bodies, and impaired endocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933411K16Rik C T 19: 42,052,673 A81V probably benign Het
Abcc9 A T 6: 142,689,127 L137* probably null Het
Akap10 A G 11: 61,886,698 probably null Het
Alms1 T A 6: 85,624,622 Y1683N probably damaging Het
Atl1 A G 12: 69,931,634 S127G probably damaging Het
Cadm1 G A 9: 47,799,410 V204M probably damaging Het
Cbr3 T A 16: 93,690,550 I207N probably damaging Het
Ccdc148 A T 2: 58,827,567 Y475N probably damaging Het
Ccdc33 A T 9: 58,080,884 S144T probably benign Het
Ceacam5 C A 7: 17,745,537 A193E probably benign Het
Chd2 T C 7: 73,469,670 D1042G probably benign Het
Clca1 T A 3: 145,011,806 N467I probably damaging Het
D130040H23Rik T C 8: 69,302,279 V112A probably damaging Het
Dbh A T 2: 27,168,306 D162V probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnm2 C T 9: 21,474,566 T295I probably benign Het
Faiml A C 9: 99,234,393 D81E probably benign Het
Fer1l4 T A 2: 156,044,557 Y720F probably benign Het
Fn1 A C 1: 71,600,538 probably benign Het
Ftsj3 T C 11: 106,252,297 E397G probably damaging Het
Gm16506 T C 14: 43,727,360 K42E Het
Gpr179 A G 11: 97,334,730 S2200P probably benign Het
Gusb T C 5: 130,000,043 D202G probably benign Het
Hspe1 A G 1: 55,089,151 E35G probably damaging Het
Kptn T A 7: 16,123,098 H170Q probably damaging Het
Lama3 G A 18: 12,462,782 A923T probably benign Het
Lmo7 T A 14: 101,887,035 I432K probably damaging Het
Maneal G A 4: 124,857,112 P284S probably benign Het
Mrgbp A G 2: 180,582,889 T28A probably benign Het
Myo1h T C 5: 114,338,229 V493A Het
Naxd T C 8: 11,506,745 L122P probably damaging Het
Neto2 T C 8: 85,670,391 probably null Het
Obscn T A 11: 59,013,252 R7299* probably null Het
Odf2l G A 3: 145,139,820 V363I possibly damaging Het
Olfr117 T C 17: 37,659,808 H175R probably damaging Het
Olfr1186 A T 2: 88,525,826 D81V probably damaging Het
Olfr1458 T A 19: 13,103,173 I44F probably benign Het
Olfr69 A T 7: 103,767,733 Y221* probably null Het
Olfr721-ps1 A G 14: 14,407,998 T257A possibly damaging Het
Otud3 G A 4: 138,896,756 P325L probably benign Het
Palb2 T C 7: 122,124,834 N564S probably benign Het
Pcnt A G 10: 76,427,927 V401A possibly damaging Het
Plcd4 G A 1: 74,565,365 E767K probably benign Het
Ppp3ca T C 3: 136,868,626 F95S probably damaging Het
Prkar2a A G 9: 108,692,622 T56A probably benign Het
Psma2 T A 13: 14,625,230 D186E probably benign Het
Psmd11 T A 11: 80,438,273 Y72* probably null Het
Ror1 G A 4: 100,302,945 D53N probably benign Het
Rubcn C T 16: 32,836,469 R527Q probably damaging Het
Sgca G A 11: 94,969,547 P255S possibly damaging Het
Skint11 A T 4: 114,227,796 R167S probably benign Het
Slco5a1 A G 1: 12,990,437 V20A probably benign Het
Snai2 T C 16: 14,707,106 S159P probably benign Het
Taar2 T G 10: 23,940,827 S88R probably damaging Het
Tacc3 T A 5: 33,667,165 N378K possibly damaging Het
Tek A G 4: 94,811,410 K342E probably benign Het
Tm9sf3 G T 19: 41,245,505 S198* probably null Het
Tmbim4 T A 10: 120,215,609 F56I possibly damaging Het
Tsen34 T A 7: 3,694,987 S85T probably benign Het
Ttc27 C A 17: 74,747,715 Q339K probably benign Het
Ubap2 G T 4: 41,205,550 P636T probably benign Het
Ubr1 G A 2: 120,875,498 L1495F probably benign Het
Vsig10 T C 5: 117,343,902 S386P probably damaging Het
Wnk2 C A 13: 49,147,177 R19L probably benign Het
Wsb2 T C 5: 117,370,879 L126P probably damaging Het
Xylb A G 9: 119,382,292 I402V probably benign Het
Yrdc A G 4: 124,850,955 S61G probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp423 C T 8: 87,780,861 G952R probably damaging Het
Zfp646 A G 7: 127,879,772 T374A possibly damaging Het
Other mutations in Chmp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03077:Chmp5 APN 4 40952438 missense probably benign 0.34
R0480:Chmp5 UTSW 4 40948690 unclassified probably benign
R0831:Chmp5 UTSW 4 40949500 missense probably damaging 1.00
R0909:Chmp5 UTSW 4 40960968 missense probably benign 0.00
R5052:Chmp5 UTSW 4 40948608 start codon destroyed probably null 0.54
R5795:Chmp5 UTSW 4 40950562 critical splice donor site probably null
R7749:Chmp5 UTSW 4 40949488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCTGAGAATTCATCTTGGG -3'
(R):5'- CATGTTAAAGGACTGTTGGGCC -3'

Sequencing Primer
(F):5'- TCTGAGAATTCATCTTGGGAAATAAC -3'
(R):5'- GCCAGGTTGTCTCGCTG -3'
Posted On2019-08-26