Incidental Mutation 'R7229:Ptprn2'
ID 568610
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
MMRRC Submission 045301-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.162) question?
Stock # R7229 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 117190845 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000064046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably null
Transcript: ENSMUST00000070733
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190247
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,832,809 (GRCm39) E122G probably benign Het
Adamts2 T C 11: 50,682,647 (GRCm39) Y880H probably damaging Het
Atp13a4 A G 16: 29,239,723 (GRCm39) S830P probably benign Het
Atp1a3 T A 7: 24,687,410 (GRCm39) Q696L probably benign Het
Brox G A 1: 183,073,523 (GRCm39) R85* probably null Het
C130073F10Rik T C 4: 101,747,439 (GRCm39) I197V probably benign Het
Cand2 G A 6: 115,768,153 (GRCm39) V433M probably damaging Het
Cep83 A G 10: 94,555,527 (GRCm39) K74E probably damaging Het
Chrng A T 1: 87,137,166 (GRCm39) T275S probably benign Het
Clca3a2 T C 3: 144,789,869 (GRCm39) D489G probably damaging Het
Cmtr1 A G 17: 29,914,398 (GRCm39) probably null Het
Cnga1 T C 5: 72,775,592 (GRCm39) N43S probably benign Het
Cog8 A T 8: 107,782,984 (GRCm39) C102S probably damaging Het
Cpsf3 G A 12: 21,346,738 (GRCm39) probably null Het
Cyp26b1 G A 6: 84,554,132 (GRCm39) Q162* probably null Het
Elmod3 A G 6: 72,571,736 (GRCm39) F14S probably benign Het
Eps8 A G 6: 137,516,354 (GRCm39) S9P probably benign Het
Fam184b T C 5: 45,741,517 (GRCm39) Q238R probably damaging Het
Fbxw7 T C 3: 84,884,676 (GRCm39) L654S unknown Het
Foxp1 A T 6: 98,912,373 (GRCm39) L580Q unknown Het
Galr1 A G 18: 82,423,789 (GRCm39) S163P probably damaging Het
Ganc T C 2: 120,258,256 (GRCm39) F201L possibly damaging Het
Gin1 T C 1: 97,712,876 (GRCm39) F310L probably benign Het
Grik2 A T 10: 48,977,512 (GRCm39) probably null Het
Haus1 A T 18: 77,851,834 (GRCm39) F94I probably benign Het
Hcn4 A G 9: 58,760,682 (GRCm39) Y409C unknown Het
Hspa1l A G 17: 35,196,231 (GRCm39) K90R probably benign Het
Icam5 T C 9: 20,948,297 (GRCm39) S702P possibly damaging Het
Ifnar1 A G 16: 91,296,444 (GRCm39) H315R probably benign Het
Klra9 T C 6: 130,168,224 (GRCm39) H14R probably damaging Het
Krt78 A G 15: 101,855,829 (GRCm39) Y661H probably benign Het
Krtap11-1 T C 16: 89,367,813 (GRCm39) T69A possibly damaging Het
L3mbtl3 C A 10: 26,168,560 (GRCm39) S598I unknown Het
Lama1 A T 17: 68,059,441 (GRCm39) D608V Het
Lrrc55 G A 2: 85,026,784 (GRCm39) T80I probably damaging Het
Lyst A T 13: 13,818,094 (GRCm39) T1255S probably benign Het
Magi2 T C 5: 20,670,586 (GRCm39) V310A probably damaging Het
Med23 C A 10: 24,777,902 (GRCm39) A750D probably benign Het
Mmp2 G A 8: 93,558,414 (GRCm39) R161Q probably damaging Het
Myo15a A T 11: 60,387,321 (GRCm39) I733F probably benign Het
Ncan A T 8: 70,552,961 (GRCm39) F1090L possibly damaging Het
Or2ag2b T G 7: 106,418,202 (GRCm39) V304G probably damaging Het
Otulinl G A 15: 27,658,273 (GRCm39) T199M probably benign Het
Pafah1b1 A G 11: 74,573,104 (GRCm39) I320T probably damaging Het
Pcdhb1 T A 18: 37,399,740 (GRCm39) Y564N probably damaging Het
Pear1 A G 3: 87,657,596 (GRCm39) S988P probably benign Het
Pgam2 A C 11: 5,753,013 (GRCm39) V194G probably damaging Het
Plvap A T 8: 71,964,221 (GRCm39) I47N probably damaging Het
Prdx6 A T 1: 161,074,867 (GRCm39) L71H probably damaging Het
Psmb11 G A 14: 54,863,408 (GRCm39) V209M probably damaging Het
Rcn2 T A 9: 55,964,763 (GRCm39) N240K probably benign Het
Rsad2 A T 12: 26,504,122 (GRCm39) Y136N probably damaging Het
Slc12a4 T G 8: 106,673,369 (GRCm39) Q734P probably benign Het
Smarcc2 T A 10: 128,323,917 (GRCm39) M1085K unknown Het
Smg1 A T 7: 117,776,178 (GRCm39) C1371S probably benign Het
Spg11 A T 2: 121,938,585 (GRCm39) F456L probably damaging Het
Srsf10 C T 4: 135,583,528 (GRCm39) probably benign Het
Stxbp5 T C 10: 9,673,931 (GRCm39) Y4C probably damaging Het
Tdrd12 T A 7: 35,179,705 (GRCm39) D881V unknown Het
Tmem171 T C 13: 98,829,133 (GRCm39) T6A probably benign Het
Tmem220 T C 11: 66,916,989 (GRCm39) L55P unknown Het
Ttn G T 2: 76,677,125 (GRCm39) P11037Q unknown Het
Tulp4 C T 17: 6,282,055 (GRCm39) H695Y probably damaging Het
Usp47 T C 7: 111,692,084 (GRCm39) S849P probably benign Het
Vcan G A 13: 89,853,389 (GRCm39) P524S possibly damaging Het
Vmn1r18 A G 6: 57,367,083 (GRCm39) M157T probably benign Het
Vmn2r109 A T 17: 20,761,225 (GRCm39) C711S possibly damaging Het
Wasf3 C T 5: 146,392,463 (GRCm39) R178C probably damaging Het
Wdr76 G A 2: 121,359,401 (GRCm39) V231I probably damaging Het
Xirp2 A T 2: 67,355,895 (GRCm39) N3552I probably damaging Het
Zfp804a A G 2: 82,088,969 (GRCm39) T933A probably benign Het
Zmynd8 A G 2: 165,699,973 (GRCm39) probably null Het
Zranb3 A T 1: 127,968,630 (GRCm39) I95K probably benign Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117,212,308 (GRCm39) missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1443:Ptprn2 UTSW 12 117,217,235 (GRCm39) missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117,148,342 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116,544,048 (GRCm39) missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117,211,337 (GRCm39) missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117,196,985 (GRCm39) splice site probably null
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117,175,482 (GRCm39) missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117,148,267 (GRCm39) missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116,822,739 (GRCm39) missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117,190,820 (GRCm39) missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116,822,571 (GRCm39) missense probably benign
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
R9605:Ptprn2 UTSW 12 117,125,278 (GRCm39) missense probably benign 0.13
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTTAAAGCACATGGAGC -3'
(R):5'- ATCATCCCAAGTTCCTGTTAGG -3'

Sequencing Primer
(F):5'- GCACATGGAGCCCACAAGG -3'
(R):5'- TAGGAAACTGCCCTTGCTG -3'
Posted On 2019-08-29