Mutagenetix > Incidental Mutation

Incidental Mutation 'R7229:Ptprn2'

568610

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R7229 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 117227225 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000064046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

AlphaFold

P80560

Predicted Effect

probably null
Transcript: ENSMUST00000070733

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190247

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	T	C	14: 54,595,352	E122G	probably benign	Het
Adamts2	T	C	11: 50,791,820	Y880H	probably damaging	Het
Atp13a4	A	G	16: 29,420,905	S830P	probably benign	Het
Atp1a3	T	A	7: 24,987,985	Q696L	probably benign	Het
Brox	G	A	1: 183,291,959	R85*	probably null	Het
C130073F10Rik	T	C	4: 101,890,242	I197V	probably benign	Het
Cand2	G	A	6: 115,791,192	V433M	probably damaging	Het
Cep83	A	G	10: 94,719,665	K74E	probably damaging	Het
Chrng	A	T	1: 87,209,444	T275S	probably benign	Het
Clca2	T	C	3: 145,084,108	D489G	probably damaging	Het
Cmtr1	A	G	17: 29,695,424		probably null	Het
Cnga1	T	C	5: 72,618,249	N43S	probably benign	Het
Cog8	A	T	8: 107,056,352	C102S	probably damaging	Het
Cpsf3	G	A	12: 21,296,737		probably null	Het
Cyp26b1	G	A	6: 84,577,150	Q162*	probably null	Het
Elmod3	A	G	6: 72,594,753	F14S	probably benign	Het
Eps8	A	G	6: 137,539,356	S9P	probably benign	Het
Fam105a	G	A	15: 27,658,187	T199M	probably benign	Het
Fam184b	T	C	5: 45,584,175	Q238R	probably damaging	Het
Fbxw7	T	C	3: 84,977,369	L654S	unknown	Het
Foxp1	A	T	6: 98,935,412	L580Q	unknown	Het
Galr1	A	G	18: 82,405,664	S163P	probably damaging	Het
Ganc	T	C	2: 120,427,775	F201L	possibly damaging	Het
Gin1	T	C	1: 97,785,151	F310L	probably benign	Het
Grik2	A	T	10: 49,101,416		probably null	Het
Haus1	A	T	18: 77,764,134	F94I	probably benign	Het
Hcn4	A	G	9: 58,853,399	Y409C	unknown	Het
Hspa1l	A	G	17: 34,977,255	K90R	probably benign	Het
Icam5	T	C	9: 21,037,001	S702P	possibly damaging	Het
Ifnar1	A	G	16: 91,499,556	H315R	probably benign	Het
Klra9	T	C	6: 130,191,261	H14R	probably damaging	Het
Krt78	A	G	15: 101,947,394	Y661H	probably benign	Het
Krtap11-1	T	C	16: 89,570,925	T69A	possibly damaging	Het
L3mbtl3	C	A	10: 26,292,662	S598I	unknown	Het
Lama1	A	T	17: 67,752,446	D608V		Het
Lrrc55	G	A	2: 85,196,440	T80I	probably damaging	Het
Lyst	A	T	13: 13,643,509	T1255S	probably benign	Het
Magi2	T	C	5: 20,465,588	V310A	probably damaging	Het
Med23	C	A	10: 24,902,004	A750D	probably benign	Het
Mmp2	G	A	8: 92,831,786	R161Q	probably damaging	Het
Myo15	A	T	11: 60,496,495	I733F	probably benign	Het
Ncan	A	T	8: 70,100,311	F1090L	possibly damaging	Het
Olfr701	T	G	7: 106,818,995	V304G	probably damaging	Het
Pafah1b1	A	G	11: 74,682,278	I320T	probably damaging	Het
Pcdhb1	T	A	18: 37,266,687	Y564N	probably damaging	Het
Pear1	A	G	3: 87,750,289	S988P	probably benign	Het
Pgam2	A	C	11: 5,803,013	V194G	probably damaging	Het
Plvap	A	T	8: 71,511,577	I47N	probably damaging	Het
Prdx6	A	T	1: 161,247,297	L71H	probably damaging	Het
Psmb11	G	A	14: 54,625,951	V209M	probably damaging	Het
Rcn2	T	A	9: 56,057,479	N240K	probably benign	Het
Rsad2	A	T	12: 26,454,123	Y136N	probably damaging	Het
Slc12a4	T	G	8: 105,946,737	Q734P	probably benign	Het
Smarcc2	T	A	10: 128,488,048	M1085K	unknown	Het
Smg1	A	T	7: 118,176,955	C1371S	probably benign	Het
Spg11	A	T	2: 122,108,104	F456L	probably damaging	Het
Srsf10	C	T	4: 135,856,217		probably benign	Het
Stxbp5	T	C	10: 9,798,187	Y4C	probably damaging	Het
Tdrd12	T	A	7: 35,480,280	D881V	unknown	Het
Tmem171	T	C	13: 98,692,625	T6A	probably benign	Het
Tmem220	T	C	11: 67,026,163	L55P	unknown	Het
Ttn	G	T	2: 76,846,781	P11037Q	unknown	Het
Tulp4	C	T	17: 6,231,780	H695Y	probably damaging	Het
Usp47	T	C	7: 112,092,877	S849P	probably benign	Het
Vcan	G	A	13: 89,705,270	P524S	possibly damaging	Het
Vmn1r18	A	G	6: 57,390,098	M157T	probably benign	Het
Vmn2r109	A	T	17: 20,540,963	C711S	possibly damaging	Het
Wasf3	C	T	5: 146,455,653	R178C	probably damaging	Het
Wdr76	G	A	2: 121,528,920	V231I	probably damaging	Het
Xirp2	A	T	2: 67,525,551	N3552I	probably damaging	Het
Zfp804a	A	G	2: 82,258,625	T933A	probably benign	Het
Zmynd8	A	G	2: 165,858,053		probably null	Het
Zranb3	A	T	1: 128,040,893	I95K	probably benign	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116841388	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116900987	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116873697	splice site	probably benign
IGL02339:Ptprn2	APN	12	116722104	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116888898	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117211943	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116876344	nonsense	probably null
BB001:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
BB011:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
IGL03014:Ptprn2	UTSW	12	117248688	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0694:Ptprn2	UTSW	12	116824355	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116722130	nonsense	probably null
R0746:Ptprn2	UTSW	12	116901017	missense	probably benign	0.00
R1127:Ptprn2	UTSW	12	117212008	splice site	probably null
R1443:Ptprn2	UTSW	12	117253615	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117184722	missense	probably damaging	1.00
R1664:Ptprn2	UTSW	12	117161709	missense	probably damaging	0.99
R1670:Ptprn2	UTSW	12	116722172	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116580428	missense	probably benign	0.00
R2075:Ptprn2	UTSW	12	117247717	missense	probably benign	0.01
R3054:Ptprn2	UTSW	12	116722133	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3109:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116888877	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116901008	missense	probably benign	0.01
R4523:Ptprn2	UTSW	12	116876000	missense	probably damaging	1.00
R4706:Ptprn2	UTSW	12	116872094	missense	probably benign	0.02
R4719:Ptprn2	UTSW	12	116824396	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117247773	nonsense	probably null
R4872:Ptprn2	UTSW	12	117161694	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117233365	splice site	probably null
R4970:Ptprn2	UTSW	12	117276595	missense	probably damaging	1.00
R5208:Ptprn2	UTSW	12	116858928	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117211862	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117184647	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116859119	missense	probably benign	0.05
R6277:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R6465:Ptprn2	UTSW	12	117269589	missense	probably damaging	0.96
R6488:Ptprn2	UTSW	12	116872038	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117227200	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116888888	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116872056	missense	probably benign	0.01
R7237:Ptprn2	UTSW	12	117161727	missense	probably benign	0.03
R7304:Ptprn2	UTSW	12	117248544	missense	probably damaging	1.00
R7355:Ptprn2	UTSW	12	116858951	missense	probably benign
R7460:Ptprn2	UTSW	12	117248681	missense	probably benign	0.05
R7577:Ptprn2	UTSW	12	116485866	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116722119	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116841320	missense	probably benign	0.10
R7924:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
R8219:Ptprn2	UTSW	12	117184737	missense	probably benign	0.30
R8716:Ptprn2	UTSW	12	117255548	missense	possibly damaging	0.73
R9235:Ptprn2	UTSW	12	117269651	critical splice donor site	probably null
R9605:Ptprn2	UTSW	12	117161658	missense	probably benign	0.13
X0066:Ptprn2	UTSW	12	117161760	missense	probably damaging	1.00
X0066:Ptprn2	UTSW	12	117184740	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- AGCCTTAAAGCACATGGAGC -3'
(R):5'- ATCATCCCAAGTTCCTGTTAGG -3'

Sequencing Primer
(F):5'- GCACATGGAGCCCACAAGG -3'
(R):5'- TAGGAAACTGCCCTTGCTG -3'

Posted On

2019-08-29