Incidental Mutation 'R7096:Myo15b'
ID568616
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Namemyosin XVB
SynonymsLOC217328, E330039G21Rik, LOC380737
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7096 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115858406-115892603 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 115891498 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000040703] [ENSMUST00000093911] [ENSMUST00000125835] [ENSMUST00000131578] [ENSMUST00000140174] [ENSMUST00000167507] [ENSMUST00000222123]
Predicted Effect probably benign
Transcript: ENSMUST00000021097
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040703
SMART Domains Protein: ENSMUSP00000048072
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
low complexity region 93 111 N/A INTRINSIC
low complexity region 179 213 N/A INTRINSIC
low complexity region 250 289 N/A INTRINSIC
low complexity region 345 370 N/A INTRINSIC
low complexity region 497 511 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
Blast:MYSc 587 775 3e-15 BLAST
SH3 778 835 1.15e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093911
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125835
SMART Domains Protein: ENSMUSP00000144423
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
SH3 75 132 7e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131578
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000222123
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T G 3: 40,933,870 M383R probably damaging Het
Acd T A 8: 105,698,489 E366V possibly damaging Het
Acvr2b T A 9: 119,428,189 probably null Het
Alg10b C T 15: 90,227,361 T136I probably benign Het
Ankrd42 T A 7: 92,591,832 K440* probably null Het
Apc T A 18: 34,315,957 S1969T probably damaging Het
Arhgef25 T C 10: 127,184,028 Y447C probably damaging Het
AW146154 G A 7: 41,481,443 A83V probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Barhl1 T G 2: 28,909,714 I300L probably benign Het
Brd1 C A 15: 88,713,935 R536L probably damaging Het
Brms1 T A 19: 5,046,680 I130N probably damaging Het
Ccdc68 A G 18: 69,940,170 H63R probably damaging Het
Ccl28 A G 13: 119,650,893 I74V probably benign Het
Cd300ld T A 11: 114,987,495 I64F possibly damaging Het
Cdkl2 G A 5: 92,033,184 Q199* probably null Het
Cdkn2c C T 4: 109,661,358 R133Q probably benign Het
Coq2 A G 5: 100,663,720 probably benign Het
Coq6 T C 12: 84,361,821 probably null Het
Csmd2 C T 4: 128,462,726 S1608L Het
Cyp11b2 T A 15: 74,855,988 R82W probably damaging Het
Cyp2d10 T C 15: 82,405,261 T217A probably benign Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dnah7a T C 1: 53,483,440 I2880V possibly damaging Het
Dync1h1 C A 12: 110,657,078 T3595K probably damaging Het
Ecscr T A 18: 35,715,425 E183V probably damaging Het
Elovl6 A G 3: 129,605,106 N52S probably benign Het
Eps8l1 G T 7: 4,474,191 A455S probably benign Het
Gpat2 A G 2: 127,428,289 N74S probably benign Het
Gstk1 C A 6: 42,249,473 T172K probably damaging Het
Gtf3c1 T C 7: 125,696,559 probably null Het
Gucy2c T C 6: 136,728,341 D532G probably benign Het
Hoxc12 T A 15: 102,937,038 N62K possibly damaging Het
Hsdl1 C A 8: 119,566,325 A124S possibly damaging Het
Il11 T C 7: 4,775,996 Y45C probably damaging Het
Lcat C T 8: 105,939,677 M404I possibly damaging Het
Ldhb A G 6: 142,501,373 F72L probably benign Het
Map10 T C 8: 125,671,923 L685P probably damaging Het
Me2 A G 18: 73,794,890 V174A probably benign Het
Med13l C A 5: 118,721,926 Q328K possibly damaging Het
Mta2 A T 19: 8,947,775 I336F probably damaging Het
Mterf1a A T 5: 3,891,769 I33N probably damaging Het
Myof C A 19: 37,936,200 G1215V probably damaging Het
Nlgn2 G A 11: 69,825,690 T675M probably damaging Het
Olfr385 T A 11: 73,589,637 M34L probably benign Het
Olfr485 C A 7: 108,159,641 M77I probably benign Het
Olfr768 T C 10: 129,093,846 I43V probably damaging Het
Padi3 T C 4: 140,800,124 D122G probably damaging Het
Pcnx3 G A 19: 5,672,615 R1350C probably damaging Het
Pdzrn4 C A 15: 92,397,503 Q197K probably benign Het
Pitpnm2 C T 5: 124,129,261 G639S possibly damaging Het
Piwil4 T A 9: 14,736,816 K156* probably null Het
Pkmyt1 T A 17: 23,734,113 H214Q probably damaging Het
Pnpt1 G A 11: 29,154,867 R597Q probably benign Het
Poteg C A 8: 27,473,567 A344E probably benign Het
Rad21l A G 2: 151,667,920 M87T probably benign Het
Ranbp17 T C 11: 33,474,896 I487V probably benign Het
Rap1gap2 C A 11: 74,392,231 R681L probably damaging Het
Rimbp2 C A 5: 128,774,269 R871L probably damaging Het
Rnf135 T C 11: 80,189,225 V114A probably benign Het
Skiv2l T A 17: 34,841,470 H849L probably benign Het
Snai2 A G 16: 14,707,164 H178R possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Taar1 A T 10: 23,920,911 E169V possibly damaging Het
Tdrd12 G T 7: 35,487,589 D625E Het
Tlr6 A G 5: 64,953,776 V596A probably benign Het
Trak2 T G 1: 58,903,590 N886H probably damaging Het
Tsga10 T A 1: 37,840,614 D32V probably damaging Het
Vmn1r214 A G 13: 23,035,026 D230G probably damaging Het
Vmn2r108 A G 17: 20,462,500 L814S probably damaging Het
Zbbx T C 3: 75,081,737 D353G probably benign Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115891916 missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115869504 nonsense probably null
IGL01539:Myo15b APN 11 115863473 missense probably benign 0.43
IGL01895:Myo15b APN 11 115883498 missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115886283 missense probably damaging 1.00
IGL02343:Myo15b APN 11 115873400 unclassified probably benign
IGL02349:Myo15b APN 11 115863105 splice site probably benign
IGL02368:Myo15b APN 11 115877002 missense probably benign 0.13
IGL02576:Myo15b APN 11 115890053 missense probably null 0.97
IGL02650:Myo15b APN 11 115886511 critical splice donor site probably null
IGL02661:Myo15b APN 11 115884069 missense probably benign 0.01
IGL02716:Myo15b APN 11 115883709 missense probably benign 0.06
IGL02733:Myo15b APN 11 115884250 missense probably benign 0.00
IGL02951:Myo15b APN 11 115881301 missense probably damaging 1.00
IGL03017:Myo15b APN 11 115887917 missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115871643 missense probably benign 0.08
ANU74:Myo15b UTSW 11 115878413 missense probably damaging 1.00
R0092:Myo15b UTSW 11 115862986 missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115886283 missense probably damaging 1.00
R0325:Myo15b UTSW 11 115884265 missense probably damaging 1.00
R0614:Myo15b UTSW 11 115882913 missense probably damaging 1.00
R0652:Myo15b UTSW 11 115864642 missense probably benign 0.07
R0711:Myo15b UTSW 11 115883838 missense probably damaging 1.00
R0815:Myo15b UTSW 11 115866336 splice site probably benign
R0961:Myo15b UTSW 11 115882454 missense probably benign 0.15
R1066:Myo15b UTSW 11 115879751 missense probably benign 0.03
R1221:Myo15b UTSW 11 115886720 missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115880501 missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115883492 small deletion probably benign
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1317:Myo15b UTSW 11 115883634 missense probably null 0.14
R1491:Myo15b UTSW 11 115886857 splice site probably null
R1552:Myo15b UTSW 11 115866635 missense probably benign 0.08
R1731:Myo15b UTSW 11 115891560 missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115880509 critical splice donor site probably null
R1843:Myo15b UTSW 11 115869586 missense probably benign 0.04
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1894:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1917:Myo15b UTSW 11 115882254 missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115863484 missense probably benign 0.30
R1939:Myo15b UTSW 11 115887703 missense probably benign 0.00
R1945:Myo15b UTSW 11 115878398 missense probably damaging 1.00
R1986:Myo15b UTSW 11 115882875 missense probably benign 0.31
R2130:Myo15b UTSW 11 115871643 missense probably benign 0.08
R2138:Myo15b UTSW 11 115883807 missense probably benign 0.00
R2176:Myo15b UTSW 11 115866572 missense probably damaging 1.00
R2415:Myo15b UTSW 11 115879564 missense probably benign 0.00
R2483:Myo15b UTSW 11 115864739 missense probably benign 0.04
R3620:Myo15b UTSW 11 115871187 missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115863413 missense probably benign 0.01
R4013:Myo15b UTSW 11 115871456 nonsense probably null
R4021:Myo15b UTSW 11 115873505 missense probably benign 0.07
R4119:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4120:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4499:Myo15b UTSW 11 115890952 missense probably benign 0.00
R4653:Myo15b UTSW 11 115879987 critical splice donor site probably null
R4655:Myo15b UTSW 11 115890697 missense probably damaging 1.00
R4700:Myo15b UTSW 11 115861935 missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115884008 missense probably benign 0.01
R4777:Myo15b UTSW 11 115879652 missense probably damaging 0.99
R4833:Myo15b UTSW 11 115887602 missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115866656 missense probably benign 0.01
R5121:Myo15b UTSW 11 115886054 missense probably damaging 1.00
R5146:Myo15b UTSW 11 115891198 missense probably benign 0.00
R5535:Myo15b UTSW 11 115881301 missense probably damaging 1.00
R5647:Myo15b UTSW 11 115871511 missense probably damaging 0.99
R5849:Myo15b UTSW 11 115881933 missense probably damaging 1.00
R5882:Myo15b UTSW 11 115869596 missense probably damaging 1.00
R5956:Myo15b UTSW 11 115873757 missense probably benign 0.34
R6273:Myo15b UTSW 11 115862799 missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115886239 missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115890831 missense probably damaging 1.00
R6462:Myo15b UTSW 11 115859442 missense probably benign 0.01
R6792:Myo15b UTSW 11 115885097 missense probably damaging 1.00
R6963:Myo15b UTSW 11 115890714 splice site probably null
R7015:Myo15b UTSW 11 115871844 missense
R7020:Myo15b UTSW 11 115866667 nonsense probably null
R7219:Myo15b UTSW 11 115877095 critical splice donor site probably null
R7400:Myo15b UTSW 11 115860113 missense
R7413:Myo15b UTSW 11 115878144 missense
R7483:Myo15b UTSW 11 115858744 missense
R7523:Myo15b UTSW 11 115890858 missense unknown
R7737:Myo15b UTSW 11 115887923 missense unknown
R7784:Myo15b UTSW 11 115861340 missense
X0020:Myo15b UTSW 11 115871799 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTCAGAGCCAAGACCCCTTCTC -3'
(R):5'- ACCTTGACCATCACAGGCAG -3'

Sequencing Primer
(F):5'- TATCCCGACCCTGACCAGACTG -3'
(R):5'- GCAGGCCCTTGATACATAGATCTTG -3'
Posted On2019-08-30