Incidental Mutation 'R7172:Susd1'
ID568619
Institutional Source Beutler Lab
Gene Symbol Susd1
Ensembl Gene ENSMUSG00000038578
Gene Namesushi domain containing 1
SynonymsGm12528
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7172 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location59314683-59438633 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 59315420 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040166] [ENSMUST00000107544]
Predicted Effect probably null
Transcript: ENSMUST00000040166
SMART Domains Protein: ENSMUSP00000048201
Gene: ENSMUSG00000038578

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
EGF 43 77 1.36e1 SMART
EGF_CA 78 129 2.92e-7 SMART
EGF_CA 130 180 2.22e-12 SMART
CCP 184 239 7.87e-9 SMART
CCP 244 299 5.48e-8 SMART
Blast:FN3 306 379 2e-6 BLAST
Blast:FN3 459 580 8e-50 BLAST
transmembrane domain 729 751 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107544
SMART Domains Protein: ENSMUSP00000103168
Gene: ENSMUSG00000038578

DomainStartEndE-ValueType
EGF 28 76 2.02e-1 SMART
EGF_CA 77 127 2.22e-12 SMART
CCP 131 186 7.87e-9 SMART
CCP 191 246 5.48e-8 SMART
Blast:FN3 253 326 2e-6 BLAST
Blast:FN3 406 527 4e-50 BLAST
transmembrane domain 676 698 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA467197 A T 2: 122,638,318 Y33F probably damaging Het
Abca4 C T 3: 122,103,540 Q623* probably null Het
Abcb1a A T 5: 8,702,399 I457F probably benign Het
Abcb9 G A 5: 124,062,806 Q716* probably null Het
Abhd15 T C 11: 77,515,296 V33A probably benign Het
Abl2 A G 1: 156,622,587 D108G probably damaging Het
Adamts3 G A 5: 89,883,001 probably benign Het
Atmin G T 8: 116,956,542 V314L probably damaging Het
Axl G T 7: 25,786,974 Q102K probably benign Het
B020004J07Rik A G 4: 101,836,996 V230A probably benign Het
Cdhr5 A G 7: 141,271,928 S488P possibly damaging Het
Cnn1 C A 9: 22,105,494 A126D probably damaging Het
Col25a1 A T 3: 130,570,332 K537* probably null Het
Cxcl2 A G 5: 90,904,020 T26A probably benign Het
Dcc T C 18: 71,378,684 T887A probably benign Het
Dhx36 T C 3: 62,501,015 D134G probably benign Het
Dnah17 T A 11: 118,041,131 K3672* probably null Het
Fadd G T 7: 144,582,171 H73Q probably benign Het
Fam35a G A 14: 34,237,568 T819I probably damaging Het
Fancm A G 12: 65,106,054 N1095D possibly damaging Het
Fhod3 T C 18: 25,085,546 S789P probably damaging Het
Glis2 G A 16: 4,613,475 V289I probably benign Het
Gm17728 A C 17: 9,422,388 D110A probably damaging Het
Gm9602 T A 14: 4,777,282 S45T possibly damaging Het
Gpr137 A G 19: 6,939,681 S161P possibly damaging Het
Gpr89 C T 3: 96,880,069 probably null Het
Gps2 C T 11: 69,916,436 T306I probably benign Het
Hmcn1 A G 1: 150,753,699 Y936H possibly damaging Het
Hoxa5 A G 6: 52,204,296 Y19H probably damaging Het
Ifit2 G T 19: 34,573,494 A145S probably benign Het
Impdh2 G T 9: 108,560,610 C26F probably benign Het
Kcnh6 T C 11: 106,020,274 Y552H possibly damaging Het
Kcnma1 A T 14: 23,526,623 M254K probably damaging Het
Klhdc9 A T 1: 171,360,660 M1K probably null Het
Klk1b11 A T 7: 43,999,247 D194V possibly damaging Het
Lama1 A G 17: 67,804,545 I2264V Het
Lmntd2 A G 7: 141,213,641 S111P unknown Het
Megf8 T C 7: 25,343,667 L1338P probably damaging Het
Mipol1 G A 12: 57,325,535 E127K possibly damaging Het
Mmp25 A T 17: 23,644,788 C23S probably benign Het
Mup8 A T 4: 60,222,425 C15* probably null Het
Myh2 A T 11: 67,188,701 T995S probably benign Het
Myo1d C T 11: 80,592,795 V863I probably benign Het
N4bp1 A G 8: 86,860,424 probably null Het
Nat10 G T 2: 103,732,969 P562T probably damaging Het
Nedd9 C G 13: 41,316,804 R291P probably benign Het
Nlrc3 G T 16: 3,963,753 H613Q probably benign Het
Ntn1 A T 11: 68,385,667 C152S probably damaging Het
Olfr332 T A 11: 58,489,745 I337F unknown Het
Pam A T 1: 97,834,478 D793E probably benign Het
Patz1 T G 11: 3,308,032 V631G probably benign Het
Pcdh15 G A 10: 74,502,765 V1068M probably damaging Het
Prmt5 A G 14: 54,514,886 F151S possibly damaging Het
Pygo2 G A 3: 89,432,636 V114I probably benign Het
Rabgap1l A T 1: 160,733,586 S220R probably benign Het
Rdh7 T G 10: 127,888,349 S89R possibly damaging Het
Rgsl1 A C 1: 153,826,220 W163G possibly damaging Het
Ryr3 T A 2: 112,661,657 N3783I probably damaging Het
Slit1 A G 19: 41,634,666 L644P probably damaging Het
Steap2 A G 5: 5,682,896 S43P possibly damaging Het
Tbc1d9 A G 8: 83,254,761 M686V probably damaging Het
Tdrp G A 8: 13,974,579 R22* probably null Het
Tmem245 A G 4: 56,903,946 V598A possibly damaging Het
Tnxb A G 17: 34,696,020 E1994G probably damaging Het
Trcg1 T A 9: 57,248,335 V757E probably benign Het
Trim10 A G 17: 36,870,063 E62G possibly damaging Het
Ushbp1 G T 8: 71,388,766 A473E possibly damaging Het
Vmn1r50 A C 6: 90,107,404 K44Q possibly damaging Het
Wdr75 A G 1: 45,799,134 N68D probably damaging Het
Wdr83 A G 8: 85,079,824 V115A probably damaging Het
Zdhhc17 A G 10: 111,009,948 L28P possibly damaging Het
Zfp738 C T 13: 67,670,408 C488Y probably damaging Het
Zfp987 T G 4: 146,122,002 L50W probably damaging Het
Zfyve28 G T 5: 34,234,409 R133S probably benign Het
Zscan20 G T 4: 128,585,676 C1007* probably null Het
Other mutations in Susd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Susd1 APN 4 59365817 missense possibly damaging 0.85
IGL01705:Susd1 APN 4 59332931 splice site probably benign
IGL01727:Susd1 APN 4 59412329 splice site probably benign
IGL02015:Susd1 APN 4 59315745 missense possibly damaging 0.86
IGL02102:Susd1 APN 4 59369636 missense possibly damaging 0.70
IGL02351:Susd1 APN 4 59427985 nonsense probably null
IGL02358:Susd1 APN 4 59427985 nonsense probably null
IGL03210:Susd1 APN 4 59333035 critical splice acceptor site probably null
IGL03258:Susd1 APN 4 59379655 missense possibly damaging 0.73
R0612:Susd1 UTSW 4 59390561 splice site probably benign
R0719:Susd1 UTSW 4 59329506 missense possibly damaging 0.56
R0722:Susd1 UTSW 4 59379749 missense possibly damaging 0.73
R1355:Susd1 UTSW 4 59424114 missense possibly damaging 0.86
R1672:Susd1 UTSW 4 59411395 missense probably damaging 0.98
R1677:Susd1 UTSW 4 59424089 missense possibly damaging 0.85
R1921:Susd1 UTSW 4 59412191 missense probably benign 0.03
R1933:Susd1 UTSW 4 59351695 missense possibly damaging 0.72
R1998:Susd1 UTSW 4 59349925 missense probably benign 0.03
R2202:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2203:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2204:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2329:Susd1 UTSW 4 59379715 missense possibly damaging 0.85
R2510:Susd1 UTSW 4 59349855 missense possibly damaging 0.86
R4512:Susd1 UTSW 4 59329491 missense possibly damaging 0.96
R4732:Susd1 UTSW 4 59428029 missense possibly damaging 0.53
R4733:Susd1 UTSW 4 59428029 missense possibly damaging 0.53
R4969:Susd1 UTSW 4 59351679 missense probably benign 0.04
R5121:Susd1 UTSW 4 59379657 missense possibly damaging 0.73
R5548:Susd1 UTSW 4 59369577 missense probably benign 0.05
R5747:Susd1 UTSW 4 59424108 missense probably damaging 0.98
R5776:Susd1 UTSW 4 59315363 utr 3 prime probably benign
R5875:Susd1 UTSW 4 59412203 missense possibly damaging 0.71
R6056:Susd1 UTSW 4 59379687 missense possibly damaging 0.53
R6081:Susd1 UTSW 4 59411359 missense possibly damaging 0.86
R7018:Susd1 UTSW 4 59390627 missense probably benign 0.44
R7122:Susd1 UTSW 4 59411318 nonsense probably null
R7161:Susd1 UTSW 4 59329581 missense possibly damaging 0.85
R7891:Susd1 UTSW 4 59349915 missense possibly damaging 0.85
R8103:Susd1 UTSW 4 59365916 critical splice acceptor site probably null
R8299:Susd1 UTSW 4 59315773 missense probably benign 0.33
R8472:Susd1 UTSW 4 59332985 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTAAGATTCCACAGAGATGGCTATC -3'
(R):5'- GAGTCATGCAGAACAGCTGG -3'

Sequencing Primer
(F):5'- CATCTCAAATTCAGGAATGAGGTC -3'
(R):5'- CATGCAGAACAGCTGGGCATG -3'
Posted On2019-08-30