Incidental Mutation 'R7191:Jakmip3'
ID568620
Institutional Source Beutler Lab
Gene Symbol Jakmip3
Ensembl Gene ENSMUSG00000056856
Gene Namejanus kinase and microtubule interacting protein 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7191 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location138940730-139083976 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 138989528 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106111] [ENSMUST00000166163] [ENSMUST00000209297]
Predicted Effect probably null
Transcript: ENSMUST00000106111
SMART Domains Protein: ENSMUSP00000101717
Gene: ENSMUSG00000056856

DomainStartEndE-ValueType
coiled coil region 9 349 N/A INTRINSIC
coiled coil region 421 452 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166163
SMART Domains Protein: ENSMUSP00000130207
Gene: ENSMUSG00000056856

DomainStartEndE-ValueType
coiled coil region 9 255 N/A INTRINSIC
low complexity region 270 282 N/A INTRINSIC
coiled coil region 289 421 N/A INTRINSIC
coiled coil region 493 524 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209297
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T A 16: 21,653,564 I129F probably benign Het
Ank2 T A 3: 126,946,392 T1948S unknown Het
Arap1 T C 7: 101,384,992 C214R probably benign Het
BC024978 G A 7: 27,201,123 A176T probably damaging Het
Ccdc82 C T 9: 13,252,472 Q130* probably null Het
Cfh A C 1: 140,112,567 V597G probably benign Het
Clp1 A T 2: 84,724,146 C226* probably null Het
Cyp39a1 G A 17: 43,731,019 W372* probably null Het
Dchs1 G A 7: 105,765,439 P799S possibly damaging Het
Dmbt1 A T 7: 131,044,520 N167I unknown Het
Dock10 A G 1: 80,540,331 S1310P possibly damaging Het
Fam83h C T 15: 76,003,037 G817D probably damaging Het
Fras1 A G 5: 96,614,912 T758A probably benign Het
Fryl T C 5: 73,072,912 H1634R probably damaging Het
Gcg C G 2: 62,476,839 G126A probably damaging Het
Gm4763 C T 7: 24,723,334 V105I possibly damaging Het
Gm4951 A T 18: 60,246,257 D288V probably benign Het
Gne T C 4: 44,040,266 K633E probably benign Het
Gpr4 T C 7: 19,223,230 V359A probably benign Het
Gprc5c C T 11: 114,868,617 T422M possibly damaging Het
Gria2 C A 3: 80,732,085 V207L probably benign Het
Hid1 T C 11: 115,348,469 *789W probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Krt16 T C 11: 100,246,658 E407G probably damaging Het
Krt81 T C 15: 101,460,229 D381G probably damaging Het
Lrrc34 C T 3: 30,624,878 G357S possibly damaging Het
Mipol1 A G 12: 57,457,066 Q340R probably benign Het
Mpzl3 T G 9: 45,055,244 M1R probably null Het
Nrcam A G 12: 44,572,244 N852S probably benign Het
Nudcd2 C T 11: 40,736,603 Q117* probably null Het
Nup35 A T 2: 80,658,379 E320V probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr477 G A 7: 107,990,646 V94M possibly damaging Het
Pkhd1 T C 1: 20,558,719 H668R probably benign Het
Ptprc T A 1: 138,101,044 D333V probably benign Het
Rdh16 A G 10: 127,813,418 K248E probably benign Het
Samd4b C A 7: 28,414,261 G93V probably benign Het
Scgn A G 13: 23,981,493 I78T probably benign Het
Slfn14 T C 11: 83,276,749 I647V probably benign Het
Smyd5 T C 6: 85,440,111 V157A probably benign Het
Syde2 T C 3: 146,002,358 M951T probably benign Het
Tas2r105 T C 6: 131,686,982 N161S probably damaging Het
Tbck T C 3: 132,737,555 F581L probably damaging Het
Traip A G 9: 107,970,017 N352D probably benign Het
Trim29 A G 9: 43,311,609 Y245C probably damaging Het
Trpv4 T C 5: 114,633,140 I443V probably benign Het
Usp36 C T 11: 118,268,834 E595K probably benign Het
Vmn2r51 T A 7: 10,100,553 Y186F probably null Het
Vmn2r97 A G 17: 18,930,286 Y465C probably damaging Het
Wrb A G 16: 96,151,945 I79V possibly damaging Het
Zfp277 A T 12: 40,329,562 H324Q probably damaging Het
Zfp987 A G 4: 146,121,903 D17G probably damaging Het
Other mutations in Jakmip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Jakmip3 APN 7 139017573 missense possibly damaging 0.71
IGL01095:Jakmip3 APN 7 139020817 missense probably damaging 1.00
IGL01356:Jakmip3 APN 7 139017612 missense probably damaging 0.99
IGL01718:Jakmip3 APN 7 138989392 missense possibly damaging 0.94
IGL01759:Jakmip3 APN 7 139020904 missense probably damaging 0.97
IGL02149:Jakmip3 APN 7 139007346 missense possibly damaging 0.57
IGL02152:Jakmip3 APN 7 139025488 missense probably damaging 1.00
IGL02691:Jakmip3 APN 7 139026844 nonsense probably null
R1175:Jakmip3 UTSW 7 139027786 missense probably damaging 1.00
R1439:Jakmip3 UTSW 7 139029646 missense probably benign 0.00
R1509:Jakmip3 UTSW 7 139027776 missense possibly damaging 0.94
R1868:Jakmip3 UTSW 7 139007587 missense probably benign 0.04
R1938:Jakmip3 UTSW 7 139020138 missense probably damaging 0.97
R2566:Jakmip3 UTSW 7 138989468 missense possibly damaging 0.88
R3418:Jakmip3 UTSW 7 139017745 intron probably benign
R4825:Jakmip3 UTSW 7 139026766 missense probably damaging 1.00
R5011:Jakmip3 UTSW 7 139020222 missense probably damaging 1.00
R5327:Jakmip3 UTSW 7 139025435 missense possibly damaging 0.54
R5519:Jakmip3 UTSW 7 139007791 missense probably damaging 1.00
R6291:Jakmip3 UTSW 7 139020856 missense probably damaging 1.00
R6393:Jakmip3 UTSW 7 139019171 missense probably damaging 1.00
R6960:Jakmip3 UTSW 7 139023336 missense probably damaging 1.00
R7116:Jakmip3 UTSW 7 139020250 missense possibly damaging 0.87
R7232:Jakmip3 UTSW 7 139007626 missense probably benign 0.00
R7385:Jakmip3 UTSW 7 139023339 missense possibly damaging 0.55
R7482:Jakmip3 UTSW 7 139025499 missense possibly damaging 0.84
R7657:Jakmip3 UTSW 7 139019174 missense probably damaging 1.00
R7814:Jakmip3 UTSW 7 139019129 missense probably damaging 1.00
R8321:Jakmip3 UTSW 7 139026884 missense probably benign
Z1176:Jakmip3 UTSW 7 139020133 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AATGTAACGGAGGACACCTGC -3'
(R):5'- GCTTTGAGCAAGAGACTTGGAG -3'

Sequencing Primer
(F):5'- CAAGAGTTTGGCGTGGATACCC -3'
(R):5'- CTTGGAGAAGGAGCTTAGGGC -3'
Posted On2019-08-30