Incidental Mutation 'R7058:Gpd2'
ID 568621
Institutional Source Beutler Lab
Gene Symbol Gpd2
Ensembl Gene ENSMUSG00000026827
Gene Name glycerol phosphate dehydrogenase 2, mitochondrial
Synonyms Gdm1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock # R7058 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 57237635-57370719 bp(+) (GRCm38)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 57307100 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000169687]
AlphaFold Q64521
Predicted Effect probably null
Transcript: ENSMUST00000028167
SMART Domains Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112618
SMART Domains Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 143 4.6e-7 PFAM
Pfam:DAO 71 441 2.9e-50 PFAM
Pfam:DAO_C 462 588 2.1e-42 PFAM
EFh 645 673 1.38e1 SMART
EFh 681 709 1.27e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169687
SMART Domains Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T C 7: 41,626,130 I419T possibly damaging Het
Afap1 T C 5: 35,962,260 V294A probably benign Het
Amotl1 T A 9: 14,575,236 Q454L possibly damaging Het
Ap2a1 T C 7: 44,900,791 S961G probably damaging Het
Asxl3 A G 18: 22,517,674 K907E probably damaging Het
BC028528 A T 3: 95,885,011 L137I possibly damaging Het
Cand1 A T 10: 119,211,754 N610K probably benign Het
Cat A G 2: 103,474,353 I109T probably benign Het
Ccdc18 T C 5: 108,193,798 V853A probably benign Het
Chd4 C A 6: 125,108,442 D805E possibly damaging Het
Cnih1 A C 14: 46,780,195 F77V probably damaging Het
Cntd1 A T 11: 101,287,426 I284F probably damaging Het
Col6a3 C A 1: 90,828,037 E177* probably null Het
Cpxm2 T A 7: 132,143,679 D139V probably benign Het
Cyp1a2 G T 9: 57,677,242 R510S probably damaging Het
D2hgdh T C 1: 93,835,374 S294P probably damaging Het
Dchs1 A G 7: 105,757,021 C2335R probably benign Het
Disc1 G T 8: 125,250,985 C719F probably damaging Het
Dnah14 A C 1: 181,698,049 D2180A probably benign Het
Dopey2 G A 16: 93,776,990 R1582Q probably benign Het
Dsg2 A T 18: 20,592,275 H481L probably benign Het
Epha6 A G 16: 59,682,650 S965P probably damaging Het
Esrrg G T 1: 188,150,306 L253F probably damaging Het
Exoc6b T C 6: 84,854,722 K438R probably damaging Het
Fam98a C A 17: 75,538,389 R454L unknown Het
Fam98c A T 7: 29,155,883 probably null Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Galnt13 A G 2: 55,098,575 T470A probably damaging Het
Ggt7 A T 2: 155,503,095 probably null Het
Golim4 T C 3: 75,878,650 E606G probably damaging Het
Grin2b T C 6: 135,780,306 M386V probably damaging Het
Hfm1 A T 5: 106,911,440 S239T probably benign Het
Hmcn1 G A 1: 150,773,890 T615I probably benign Het
Hook2 G A 8: 84,997,411 E446K possibly damaging Het
Hsd3b1 C T 3: 98,857,815 probably null Het
Igsf9b A G 9: 27,322,854 Y421C probably damaging Het
Il21 A G 3: 37,232,480 L29P probably damaging Het
Ildr1 A G 16: 36,722,368 S421G probably benign Het
Kat2b C A 17: 53,665,866 T736K probably benign Het
Kcng1 A G 2: 168,262,609 V439A probably damaging Het
Kif21a A T 15: 90,948,903 probably null Het
Lat A G 7: 126,369,146 probably null Het
Mastl T A 2: 23,133,413 K433* probably null Het
Mettl2 A G 11: 105,128,893 R119G probably benign Het
Mia2 C T 12: 59,184,235 P1223L possibly damaging Het
Mkrn2os G T 6: 115,586,674 D133E probably benign Het
Mslnl A G 17: 25,743,212 T195A probably benign Het
Muc16 T G 9: 18,639,755 T5081P probably benign Het
Mylpf G C 7: 127,213,967 R110P probably damaging Het
Myo19 G T 11: 84,907,368 C738F possibly damaging Het
Nat8f4 T A 6: 85,901,289 N84I possibly damaging Het
Nol8 C T 13: 49,676,386 R1104C probably damaging Het
Notch1 A T 2: 26,463,818 D1932E probably benign Het
Nsun3 A T 16: 62,776,300 C152S possibly damaging Het
Olfr116 A G 17: 37,623,706 F310L probably benign Het
Opcml G A 9: 28,675,211 W75* probably null Het
Pcdh7 G A 5: 57,722,240 E1046K probably damaging Het
Pcdhb9 T A 18: 37,403,281 V776D probably benign Het
Pla2g4a A G 1: 149,851,352 L551S probably damaging Het
Plaa G A 4: 94,569,823 Q637* probably null Het
Plekhh1 A T 12: 79,075,430 E1099V probably damaging Het
Ppp4r1 A T 17: 65,829,500 N551Y probably benign Het
R3hdm2 T C 10: 127,484,513 V554A probably damaging Het
Rab44 A G 17: 29,138,176 probably null Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rasgrf2 T C 13: 91,886,402 T1119A probably damaging Het
Rims2 A G 15: 39,585,648 D1194G probably damaging Het
Scarb1 A T 5: 125,297,230 C280S probably damaging Het
Sde2 T C 1: 180,866,262 F439S probably damaging Het
Setd5 T C 6: 113,115,571 I304T probably benign Het
Sipa1l1 A G 12: 82,403,122 E1106G probably benign Het
Sis T G 3: 72,903,607 S1694R probably damaging Het
Smad9 T A 3: 54,786,193 F181Y probably benign Het
Smg1 A G 7: 118,198,279 probably benign Het
Sspo T C 6: 48,448,582 Y46H probably damaging Het
Tdrd12 A G 7: 35,478,109 M940T unknown Het
Tmem44 G T 16: 30,547,395 T71K possibly damaging Het
Tmf1 T A 6: 97,156,950 E1009V probably damaging Het
Ttc39a C T 4: 109,431,566 R288W probably damaging Het
Ttc9c G A 19: 8,818,827 probably benign Het
Usp28 T A 9: 49,039,156 Y634N probably damaging Het
Vmn1r211 C T 13: 22,851,893 M201I probably benign Het
Vmn2r54 T A 7: 12,615,795 Q620L possibly damaging Het
Vps13c T C 9: 67,923,828 L1580P probably benign Het
Vrk3 C A 7: 44,768,466 F308L probably damaging Het
Zdbf2 T A 1: 63,307,404 H1647Q possibly damaging Het
Zfp984 A T 4: 147,755,545 M283K probably benign Het
Other mutations in Gpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Gpd2 APN 2 57268084 critical splice donor site probably null
IGL01012:Gpd2 APN 2 57364530 missense probably benign 0.00
IGL01096:Gpd2 APN 2 57338867 missense probably damaging 0.98
IGL01642:Gpd2 APN 2 57268071 nonsense probably null
IGL01816:Gpd2 APN 2 57364066 nonsense probably null
IGL02257:Gpd2 APN 2 57364524 missense probably benign 0.01
IGL02824:Gpd2 APN 2 57364327 missense probably null 0.89
IGL02832:Gpd2 APN 2 57338979 missense probably damaging 1.00
IGL03040:Gpd2 APN 2 57355793 missense probably benign 0.06
IGL03107:Gpd2 APN 2 57355569 missense probably damaging 1.00
IGL03131:Gpd2 APN 2 57338843 splice site probably benign
IGL03218:Gpd2 APN 2 57307054 missense probably damaging 1.00
IGL03226:Gpd2 APN 2 57304486 critical splice donor site probably null
IGL03372:Gpd2 APN 2 57355507 missense probably damaging 1.00
R0012:Gpd2 UTSW 2 57338868 missense probably damaging 1.00
R0285:Gpd2 UTSW 2 57338955 missense probably benign 0.16
R0379:Gpd2 UTSW 2 57345263 missense probably damaging 1.00
R0401:Gpd2 UTSW 2 57340093 missense possibly damaging 0.94
R1347:Gpd2 UTSW 2 57357671 missense probably damaging 0.99
R1347:Gpd2 UTSW 2 57357671 missense probably damaging 0.99
R1468:Gpd2 UTSW 2 57355774 missense probably damaging 1.00
R1468:Gpd2 UTSW 2 57355774 missense probably damaging 1.00
R1490:Gpd2 UTSW 2 57355475 missense probably damaging 1.00
R1672:Gpd2 UTSW 2 57357700 missense probably damaging 0.97
R1709:Gpd2 UTSW 2 57357655 missense probably damaging 1.00
R1735:Gpd2 UTSW 2 57355551 missense probably damaging 1.00
R2056:Gpd2 UTSW 2 57339013 critical splice donor site probably null
R2959:Gpd2 UTSW 2 57338975 nonsense probably null
R2960:Gpd2 UTSW 2 57338975 nonsense probably null
R2961:Gpd2 UTSW 2 57338975 nonsense probably null
R2962:Gpd2 UTSW 2 57338975 nonsense probably null
R3008:Gpd2 UTSW 2 57338975 nonsense probably null
R3009:Gpd2 UTSW 2 57338975 nonsense probably null
R3881:Gpd2 UTSW 2 57338975 nonsense probably null
R4073:Gpd2 UTSW 2 57290013 missense probably damaging 1.00
R4153:Gpd2 UTSW 2 57355771 missense probably damaging 1.00
R4564:Gpd2 UTSW 2 57307083 missense possibly damaging 0.77
R4952:Gpd2 UTSW 2 57307013 nonsense probably null
R5030:Gpd2 UTSW 2 57304405 missense probably damaging 0.98
R5101:Gpd2 UTSW 2 57355901 missense probably damaging 1.00
R5185:Gpd2 UTSW 2 57340204 missense probably damaging 1.00
R6020:Gpd2 UTSW 2 57364513 missense probably benign 0.18
R6325:Gpd2 UTSW 2 57304396 missense probably damaging 0.96
R6536:Gpd2 UTSW 2 57345355 missense probably benign 0.40
R6923:Gpd2 UTSW 2 57355788 missense probably damaging 0.98
R7380:Gpd2 UTSW 2 57340159 missense probably damaging 1.00
R8052:Gpd2 UTSW 2 57306950 nonsense probably null
R8098:Gpd2 UTSW 2 57290008 missense possibly damaging 0.94
R8467:Gpd2 UTSW 2 57364584 missense possibly damaging 0.95
R8851:Gpd2 UTSW 2 57307050 missense possibly damaging 0.62
R9515:Gpd2 UTSW 2 57305854 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGCCAATCTATAGTGCTATACCGTG -3'
(R):5'- GTTAGAAGCAAATCATTGTGGGTAG -3'

Sequencing Primer
(F):5'- CTCTCTCTGCTTATGCTATAGGTGG -3'
(R):5'- GGGTAGTTTTTCAGCCAATACTACC -3'
Posted On 2019-09-05