Incidental Mutation 'R7113:Vmn2r72'
ID568626
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R7113 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) A to T at 85749803 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
Predicted Effect probably null
Transcript: ENSMUST00000063425
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 95% (53/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 T C 13: 104,312,759 S226P probably benign Het
Adarb2 T C 13: 8,731,845 Y586H probably damaging Het
Ano7 A T 1: 93,385,620 E160V probably benign Het
Apob G C 12: 7,995,539 A895P probably damaging Het
Ccdc157 T C 11: 4,148,889 T206A possibly damaging Het
Ceacam18 A G 7: 43,641,976 N281D probably benign Het
Chil4 T C 3: 106,202,767 D337G probably damaging Het
Chil4 T G 3: 106,214,348 K62Q probably benign Het
Cic A T 7: 25,273,444 I867F probably benign Het
Cntln A G 4: 85,049,827 E761G probably damaging Het
Cyp2d26 T A 15: 82,790,202 Y493F probably benign Het
Dync2h1 A T 9: 7,075,788 F3026L probably benign Het
Ehd3 T A 17: 73,830,184 D449E probably benign Het
Gm5152 G A 5: 10,243,010 P189S Het
Gm884 A G 11: 103,618,799 I781T unknown Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Herc2 T G 7: 56,203,849 D3696E probably damaging Het
Hivep3 T A 4: 120,098,369 I1294N probably damaging Het
Il19 T C 1: 130,934,995 I139V probably benign Het
Jmjd1c T A 10: 67,158,001 I87N probably damaging Het
Kcnma1 A G 14: 23,463,156 Y392H probably damaging Het
Kcnv2 T C 19: 27,324,048 L433P probably damaging Het
Kif9 A T 9: 110,506,664 N378Y probably damaging Het
Lonrf1 A T 8: 36,230,510 V440E probably benign Het
Manea A T 4: 26,336,718 L186Q probably damaging Het
Mas1 A G 17: 12,842,437 I33T probably benign Het
Med13l A G 5: 118,726,265 S389G probably benign Het
Nxph3 T C 11: 95,511,066 N174S possibly damaging Het
Olfr365 T A 2: 37,201,556 F105Y possibly damaging Het
Olfr965 G C 9: 39,719,677 C150S probably benign Het
Pcdha5 A G 18: 36,961,704 D422G probably benign Het
Pias4 A C 10: 81,154,453 V416G possibly damaging Het
Pik3cg T A 12: 32,205,667 Y107F probably damaging Het
Plcg1 T A 2: 160,748,283 W156R possibly damaging Het
Plcl2 A G 17: 50,606,464 D167G probably damaging Het
Podxl T A 6: 31,524,733 probably null Het
Ppp1r2 T C 16: 31,254,718 D197G probably benign Het
Ptprs C G 17: 56,451,697 V175L probably benign Het
Rad17 A T 13: 100,629,517 S368T probably benign Het
Rdh8 G T 9: 20,825,327 R230L probably benign Het
Rpl35 A C 2: 39,004,156 L58R probably damaging Het
Rtp3 A C 9: 110,986,699 C199W probably damaging Het
S100pbp G A 4: 129,182,103 T143I probably damaging Het
Scarf1 A G 11: 75,526,078 E782G probably damaging Het
Slc30a9 T C 5: 67,326,862 V114A probably benign Het
Stpg2 G A 3: 139,701,774 probably null Het
Tdpoz1 T C 3: 93,670,806 S224G possibly damaging Het
Triml2 T A 8: 43,183,333 Y52N probably benign Het
Trpm2 A T 10: 77,947,931 I236N probably damaging Het
Unc5c A G 3: 141,801,293 D602G probably benign Het
Upk1a A G 7: 30,609,811 S29P probably damaging Het
Vmn2r54 A G 7: 12,616,074 L527P probably damaging Het
Vstm2l G T 2: 157,914,729 probably benign Het
Vwf G T 6: 125,655,044 G1952V Het
Zfand6 A C 7: 84,615,869 I208S probably damaging Het
Zfp236 A G 18: 82,620,337 I1386T possibly damaging Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85754890 missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATCCACATCTGTAGCCCAC -3'
(R):5'- TGTGGAACTACCTTTACATCCAC -3'

Sequencing Primer
(F):5'- ACATCTGTAGCCCACTCCATC -3'
(R):5'- CATCCACGTGAAATTTATTCTTGC -3'
Posted On2019-09-05