Incidental Mutation 'R0639:Rassf5'
ID 56863
Institutional Source Beutler Lab
Gene Symbol Rassf5
Ensembl Gene ENSMUSG00000026430
Gene Name Ras association (RalGDS/AF-6) domain family member 5
Synonyms Rapl, 1300019G20Rik, Nore1A, Nore1B
MMRRC Submission 038828-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R0639 (G1)
Quality Score 143
Status Not validated
Chromosome 1
Chromosomal Location 131104147-131172915 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 131172803 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 22 (Y22C)
Ref Sequence ENSEMBL: ENSMUSP00000108061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027688] [ENSMUST00000112442]
AlphaFold Q5EBH1
Predicted Effect probably damaging
Transcript: ENSMUST00000027688
AA Change: Y22C

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027688
Gene: ENSMUSG00000026430
AA Change: Y22C

DomainStartEndE-ValueType
low complexity region 31 39 N/A INTRINSIC
low complexity region 49 67 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
C1 116 165 6.29e-8 SMART
RA 267 359 1.07e-22 SMART
Pfam:Nore1-SARAH 366 405 1.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112442
AA Change: Y22C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108061
Gene: ENSMUSG00000026430
AA Change: Y22C

DomainStartEndE-ValueType
low complexity region 31 39 N/A INTRINSIC
low complexity region 49 67 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
C1 116 165 6.29e-8 SMART
PDB:3DDC|B 198 301 7e-62 PDB
Blast:RA 267 294 5e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124796
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ras association domain family. It functions as a tumor suppressor, and is inactivated in a variety of cancers. The encoded protein localizes to centrosomes and microtubules, and associates with the GTP-activated forms of Ras, Rap1, and several other Ras-like small GTPases. The protein regulates lymphocyte adhesion and suppresses cell growth in response to activated Rap1 or Ras. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele have defects in lymphocyte homing to lymphoid tissues, B cell maturation and dendritic cell function, and display lymphocyte hyperproliferation leading to lupus glomerulonephritis and lymphomas. Homozygotes for another null allele are resistant to TNF-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 46,043,999 (GRCm39) W86* probably null Het
Acadl T C 1: 66,896,567 (GRCm39) H75R probably benign Het
Adamtsl1 T C 4: 86,195,380 (GRCm39) F599S probably damaging Het
Adrb3 T C 8: 27,718,293 (GRCm39) N52S probably damaging Het
Agbl3 T A 6: 34,776,640 (GRCm39) L377Q probably damaging Het
Akap9 T C 5: 4,110,318 (GRCm39) L3007P probably damaging Het
Amer3 T A 1: 34,626,902 (GRCm39) Y380* probably null Het
Ankrd13d A T 19: 4,323,047 (GRCm39) probably null Het
Ap4m1 T A 5: 138,174,501 (GRCm39) C235S probably benign Het
Arhgap29 T C 3: 121,801,290 (GRCm39) F675S probably damaging Het
Asah2 C A 19: 31,986,039 (GRCm39) V544F probably damaging Het
Ash2l A G 8: 26,313,319 (GRCm39) I389T possibly damaging Het
Bend5 T C 4: 111,290,495 (GRCm39) S164P probably benign Het
Cacna1d A G 14: 29,893,251 (GRCm39) probably null Het
Cdc25b A G 2: 131,039,182 (GRCm39) N516D probably benign Het
Cdc27 A G 11: 104,422,560 (GRCm39) Y125H probably damaging Het
Cdk5r2 C T 1: 74,894,995 (GRCm39) L247F probably damaging Het
Cenpf C A 1: 189,390,259 (GRCm39) G1191V probably benign Het
Cops4 C T 5: 100,685,326 (GRCm39) T293I possibly damaging Het
Csmd3 A G 15: 47,777,336 (GRCm39) L1294P probably damaging Het
Dclre1a T C 19: 56,526,872 (GRCm39) Y848C probably damaging Het
Disp2 A T 2: 118,621,325 (GRCm39) I686F possibly damaging Het
Dnah6 T A 6: 72,999,395 (GRCm39) Y4012F probably benign Het
Dnajc11 C G 4: 152,054,393 (GRCm39) R200G probably damaging Het
Dnhd1 A T 7: 105,345,671 (GRCm39) D2272V possibly damaging Het
Elane A C 10: 79,722,183 (GRCm39) R5S possibly damaging Het
Entpd7 G A 19: 43,679,533 (GRCm39) V29M probably benign Het
Fanca A G 8: 124,016,098 (GRCm39) probably null Het
Fgl1 G T 8: 41,644,661 (GRCm39) T281K probably benign Het
Flii T C 11: 60,613,823 (GRCm39) probably null Het
Foxn1 T C 11: 78,261,970 (GRCm39) D133G possibly damaging Het
Fzd7 T A 1: 59,523,719 (GRCm39) M534K probably damaging Het
Galnt5 A G 2: 57,889,407 (GRCm39) T336A probably benign Het
Gli3 G A 13: 15,899,300 (GRCm39) D896N probably damaging Het
Gsx1 G T 5: 147,126,756 (GRCm39) W193L probably damaging Het
Gtpbp3 A T 8: 71,945,379 (GRCm39) I485F probably damaging Het
H2-M11 A G 17: 36,858,283 (GRCm39) T26A probably benign Het
Igfbp7 T C 5: 77,499,827 (GRCm39) D243G probably damaging Het
Il31ra A T 13: 112,662,377 (GRCm39) D477E possibly damaging Het
Inmt A C 6: 55,148,212 (GRCm39) V139G probably damaging Het
Inpp5j T A 11: 3,451,147 (GRCm39) M501L probably benign Het
Itsn2 T C 12: 4,762,556 (GRCm39) F1579L probably damaging Het
Kat2b C A 17: 53,874,566 (GRCm39) A70E probably benign Het
Klhl20 T C 1: 160,921,281 (GRCm39) E58G probably damaging Het
Krt79 A T 15: 101,839,983 (GRCm39) Y337* probably null Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Letm1 T C 5: 33,926,770 (GRCm39) I176V possibly damaging Het
Lingo3 C A 10: 80,671,618 (GRCm39) R104L probably benign Het
Lrig3 T G 10: 125,846,090 (GRCm39) C840G probably damaging Het
Lrrc9 A G 12: 72,533,062 (GRCm39) N977S probably damaging Het
Lrrk2 T A 15: 91,657,199 (GRCm39) M1831K probably benign Het
Mn1 A T 5: 111,567,182 (GRCm39) D384V probably damaging Het
Morc3 C A 16: 93,650,738 (GRCm39) H319Q probably damaging Het
Morn1 T C 4: 155,173,960 (GRCm39) F56L possibly damaging Het
Mrpl53 G T 6: 83,086,392 (GRCm39) V64L probably damaging Het
Myo15a T A 11: 60,370,162 (GRCm39) V974D probably benign Het
Neb A G 2: 52,146,136 (GRCm39) V2947A possibly damaging Het
Nfasc A C 1: 132,531,554 (GRCm39) N737K probably damaging Het
Nlk T C 11: 78,463,103 (GRCm39) D464G possibly damaging Het
Nlrc4 C T 17: 74,733,958 (GRCm39) R985K probably benign Het
Nsun6 T C 2: 15,001,147 (GRCm39) K470E probably benign Het
Nup85 T G 11: 115,455,357 (GRCm39) M1R probably null Het
Or8b39 G A 9: 37,996,666 (GRCm39) C178Y probably damaging Het
Otop1 T C 5: 38,445,292 (GRCm39) V150A possibly damaging Het
Pclo C T 5: 14,731,763 (GRCm39) R296* probably null Het
Pdzd2 A T 15: 12,458,144 (GRCm39) C240S possibly damaging Het
Plekhg5 A G 4: 152,198,577 (GRCm39) T922A probably benign Het
Plekhm2 A C 4: 141,369,381 (GRCm39) L101R probably damaging Het
Plscr3 T A 11: 69,738,820 (GRCm39) C161S probably benign Het
Prr14l C T 5: 32,986,259 (GRCm39) D1079N probably benign Het
Ptpru A T 4: 131,498,490 (GRCm39) V1377E possibly damaging Het
Rab37 C A 11: 115,049,528 (GRCm39) D112E probably benign Het
Raet1e T A 10: 22,050,274 (GRCm39) I19N probably damaging Het
Rp1 T C 1: 4,416,721 (GRCm39) T1464A probably benign Het
Safb T A 17: 56,908,092 (GRCm39) probably benign Het
Scarf2 A G 16: 17,624,369 (GRCm39) probably null Het
Scart2 A G 7: 139,827,872 (GRCm39) N27D probably benign Het
Sh3d19 T C 3: 86,014,280 (GRCm39) S415P probably benign Het
Slc26a9 T A 1: 131,691,542 (GRCm39) L595Q probably damaging Het
Slc4a8 T C 15: 100,694,431 (GRCm39) Y470H probably damaging Het
Slitrk3 T C 3: 72,956,982 (GRCm39) N597D probably benign Het
Spata31 T A 13: 65,070,027 (GRCm39) V725E probably benign Het
Spink12 T A 18: 44,240,831 (GRCm39) C72* probably null Het
Spink5 T A 18: 44,146,042 (GRCm39) probably null Het
Stk40 C A 4: 126,012,125 (GRCm39) S9* probably null Het
Sypl1 A T 12: 33,015,420 (GRCm39) T40S probably damaging Het
Tbc1d8 C T 1: 39,430,290 (GRCm39) E438K probably benign Het
Tdrd7 A G 4: 45,989,102 (GRCm39) T111A probably benign Het
Tg A T 15: 66,613,333 (GRCm39) probably null Het
Tlr5 T A 1: 182,801,454 (GRCm39) W253R probably damaging Het
Tmprss11c C T 5: 86,383,328 (GRCm39) C353Y probably damaging Het
Tnfrsf8 T A 4: 145,014,597 (GRCm39) M271L probably benign Het
Toe1 T C 4: 116,663,947 (GRCm39) N21S probably benign Het
Tpp2 T C 1: 44,014,607 (GRCm39) F649L probably benign Het
Ttll1 G A 15: 83,386,426 (GRCm39) Q60* probably null Het
Vcp C T 4: 42,982,565 (GRCm39) R709Q probably benign Het
Vmn1r119 T A 7: 20,745,593 (GRCm39) H263L possibly damaging Het
Vmn1r195 C A 13: 22,463,111 (GRCm39) Q194K probably damaging Het
Vmn1r33 T C 6: 66,588,783 (GRCm39) Y257C probably damaging Het
Vmn2r15 A G 5: 109,440,881 (GRCm39) F326L probably benign Het
Wbp11 A T 6: 136,793,108 (GRCm39) probably benign Het
Wwp2 T G 8: 108,244,578 (GRCm39) V250G probably benign Het
Xpnpep3 T C 15: 81,315,038 (GRCm39) V246A probably benign Het
Zcchc14 G A 8: 122,332,188 (GRCm39) R419* probably null Het
Other mutations in Rassf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Rassf5 APN 1 131,108,336 (GRCm39) missense probably damaging 0.96
IGL03055:Rassf5 UTSW 1 131,172,732 (GRCm39) missense probably benign 0.00
R0464:Rassf5 UTSW 1 131,139,998 (GRCm39) missense probably benign 0.00
R0589:Rassf5 UTSW 1 131,172,720 (GRCm39) missense probably damaging 0.99
R0634:Rassf5 UTSW 1 131,172,693 (GRCm39) missense probably damaging 0.99
R0727:Rassf5 UTSW 1 131,109,002 (GRCm39) missense probably damaging 1.00
R1926:Rassf5 UTSW 1 131,140,076 (GRCm39) missense probably damaging 1.00
R2310:Rassf5 UTSW 1 131,172,477 (GRCm39) missense probably damaging 1.00
R5354:Rassf5 UTSW 1 131,108,385 (GRCm39) missense probably benign 0.00
R5422:Rassf5 UTSW 1 131,108,911 (GRCm39) missense possibly damaging 0.87
R5490:Rassf5 UTSW 1 131,108,932 (GRCm39) missense possibly damaging 0.95
R6189:Rassf5 UTSW 1 131,172,716 (GRCm39) missense probably damaging 1.00
R6328:Rassf5 UTSW 1 131,108,405 (GRCm39) missense probably damaging 1.00
R6531:Rassf5 UTSW 1 131,172,551 (GRCm39) missense possibly damaging 0.93
R6759:Rassf5 UTSW 1 131,109,988 (GRCm39) missense probably benign 0.08
R7115:Rassf5 UTSW 1 131,108,986 (GRCm39) missense probably benign 0.21
R7350:Rassf5 UTSW 1 131,106,273 (GRCm39) missense possibly damaging 0.75
R7910:Rassf5 UTSW 1 131,108,366 (GRCm39) missense probably benign 0.15
R8286:Rassf5 UTSW 1 131,140,067 (GRCm39) missense possibly damaging 0.73
R8706:Rassf5 UTSW 1 131,172,782 (GRCm39) missense probably benign 0.00
R8732:Rassf5 UTSW 1 131,106,264 (GRCm39) makesense probably null
R9023:Rassf5 UTSW 1 131,140,077 (GRCm39) missense probably benign 0.07
Z1176:Rassf5 UTSW 1 131,109,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCAGTGGGCAGCCATTAAAGG -3'
(R):5'- AGTCGCCGAGTCACTCCTAAATCC -3'

Sequencing Primer
(F):5'- GCTGTCTCCAAAGGTAACCTG -3'
(R):5'- TCCTAAATCCACGCGGCTC -3'
Posted On 2013-07-11