Incidental Mutation 'R7221:Rubcn'
ID568639
Institutional Source Beutler Lab
Gene Symbol Rubcn
Ensembl Gene ENSMUSG00000035629
Gene NameRUN domain and cysteine-rich domain containing, Beclin 1-interacting protein
Synonyms1700021K19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R7221 (G1)
Quality Score97.0078
Status Validated
Chromosome16
Chromosomal Location32821703-32877766 bp(-) (GRCm38)
Type of Mutationintron (1170 bp from exon)
DNA Base Change (assembly) T to C at 32866923 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040986] [ENSMUST00000089684] [ENSMUST00000115105] [ENSMUST00000119810] [ENSMUST00000231478] [ENSMUST00000232269]
Predicted Effect probably null
Transcript: ENSMUST00000040986
SMART Domains Protein: ENSMUSP00000048811
Gene: ENSMUSG00000035629

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 339 371 N/A INTRINSIC
Blast:DUF4206 469 687 1e-66 BLAST
DUF4206 706 908 1.66e-113 SMART
low complexity region 915 941 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000089684
SMART Domains Protein: ENSMUSP00000087114
Gene: ENSMUSG00000035629

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 339 371 N/A INTRINSIC
Blast:DUF4206 484 702 1e-66 BLAST
DUF4206 721 923 1.66e-113 SMART
low complexity region 930 956 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115105
SMART Domains Protein: ENSMUSP00000110757
Gene: ENSMUSG00000035629

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
RUN 123 183 1.67e-15 SMART
low complexity region 230 254 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
Blast:DUF4206 455 673 1e-66 BLAST
DUF4206 692 894 1.66e-113 SMART
low complexity region 901 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119810
SMART Domains Protein: ENSMUSP00000113087
Gene: ENSMUSG00000035629

DomainStartEndE-ValueType
RUN 62 122 1.67e-15 SMART
low complexity region 169 193 N/A INTRINSIC
low complexity region 278 310 N/A INTRINSIC
Blast:DUF4206 408 626 6e-67 BLAST
DUF4206 645 847 1.66e-113 SMART
low complexity region 854 880 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000231478
Predicted Effect probably null
Transcript: ENSMUST00000232269
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of autophagy and endocytic trafficking and controls endosome maturation. This protein contains two conserved domains, an N-terminal RUN domain and a C-terminal DUF4206 domain. The RUN domain is involved in Ras-like GTPase signaling, and the DUF4206 domain contains a diacylglycerol (DAG) binding-like motif. Mutation in this gene results in deletion of the DAG binding-like motif and causes a recessive ataxia. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik T G 3: 108,475,001 D232A possibly damaging Het
Abr A C 11: 76,423,161 M720R probably benign Het
Acad10 G A 5: 121,630,210 T761M probably damaging Het
Agxt G T 1: 93,137,901 G164V possibly damaging Het
Ankar C T 1: 72,650,231 G1247D probably damaging Het
Bptf A C 11: 107,054,832 L2527R probably damaging Het
Brinp2 T C 1: 158,266,547 H195R possibly damaging Het
C130079G13Rik A G 3: 59,928,933 probably benign Het
Cacna2d4 G T 6: 119,236,663 R14S probably benign Het
Cep126 A T 9: 8,100,987 C515* probably null Het
Chia1 A T 3: 106,131,920 N442I probably damaging Het
Clasp2 A G 9: 113,852,757 D327G probably damaging Het
Cnbd2 T C 2: 156,373,661 F519L probably benign Het
Cntrl T A 2: 35,151,857 F1214I possibly damaging Het
Cul9 A T 17: 46,528,565 M829K probably damaging Het
Cyp4b1 T C 4: 115,635,978 Q223R possibly damaging Het
Defb37 A T 8: 18,990,972 M1K probably null Het
Dnah7c A T 1: 46,455,777 Q55L possibly damaging Het
Eif2b4 A T 5: 31,187,787 D463E possibly damaging Het
Elovl1 C T 4: 118,431,614 H167Y probably damaging Het
Emb T A 13: 117,267,477 L255Q probably damaging Het
Eogt T C 6: 97,112,724 Y465C probably damaging Het
Erc2 A G 14: 27,653,158 H111R probably damaging Het
Fam234b T C 6: 135,228,531 F498S probably damaging Het
Fgfr3 GAGGCTGGCAGCGTGTACGCAGGC GAGGC 5: 33,732,748 probably null Het
Flrt3 T A 2: 140,661,170 E179D probably damaging Het
Fndc3a T C 14: 72,556,157 R993G probably benign Het
Gm11639 A G 11: 104,900,606 N2882S probably benign Het
Gm13762 A G 2: 88,973,153 V246A probably damaging Het
Gm14325 T C 2: 177,834,610 T14A probably damaging Het
Gm5464 T A 14: 66,869,232 V106D unknown Het
Gm7697 T G 8: 69,522,664 D50A probably benign Het
Gpatch11 T A 17: 78,842,117 I182N possibly damaging Het
Grm6 A G 11: 50,863,043 R725G probably damaging Het
Hap1 A T 11: 100,348,829 M588K probably benign Het
Icam2 A G 11: 106,382,442 F15L probably benign Het
Ints8 A G 4: 11,225,613 M648T probably benign Het
Ipo11 A T 13: 106,892,557 L296Q probably damaging Het
Kirrel G A 3: 87,086,397 Q518* probably null Het
Krt18 G T 15: 102,029,532 D155Y possibly damaging Het
Lctl A T 9: 64,118,935 K91* probably null Het
Marf1 C A 16: 14,142,485 R565L probably damaging Het
Med13 A T 11: 86,288,095 D1458E probably benign Het
Mroh8 T A 2: 157,229,917 Y556F probably benign Het
Muc16 C T 9: 18,642,199 G4266D probably benign Het
Nsrp1 A T 11: 77,048,423 F182I probably damaging Het
Obox3 A T 7: 15,626,058 Y229N probably benign Het
Olfr1184 T A 2: 88,487,629 V299D probably damaging Het
Olfr124 A G 17: 37,805,561 K139E probably benign Het
Olfr1247 T C 2: 89,609,928 Y58C probably damaging Het
Olfr1359 T C 13: 21,703,102 S34P probably damaging Het
Olfr26 A G 9: 38,855,242 Y60C probably damaging Het
Olfr746 A T 14: 50,654,071 Y278F probably damaging Het
Pabpc2 T A 18: 39,773,910 V76D possibly damaging Het
Parp9 T C 16: 35,953,701 W348R probably benign Het
Pdp1 T C 4: 11,961,004 T455A probably damaging Het
Phactr2 A C 10: 13,247,039 D446E possibly damaging Het
Pi4kb T C 3: 94,994,189 L389P probably damaging Het
Pla2g4f C T 2: 120,300,995 R749H probably benign Het
Plec A G 15: 76,175,774 V3321A probably damaging Het
Plod2 T C 9: 92,584,527 V180A probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Sacs T C 14: 61,208,806 V2767A probably damaging Het
Selenbp2 C G 3: 94,703,826 Y414* probably null Het
Slc45a4 A T 15: 73,586,410 M430K probably benign Het
Smg1 A G 7: 118,182,797 L1145P possibly damaging Het
Spns2 A G 11: 72,456,916 V316A probably benign Het
Srl T A 16: 4,482,947 E753D probably damaging Het
Thada T C 17: 84,464,366 T23A possibly damaging Het
Tmem231 T C 8: 111,933,676 T31A probably benign Het
Tpr C T 1: 150,446,178 T2321M possibly damaging Het
Ttn T A 2: 76,941,851 N2615I unknown Het
Vmn1r41 A G 6: 89,747,052 I192V probably benign Het
Vmn2r83 A T 10: 79,480,167 T466S probably benign Het
Vnn1 A G 10: 23,895,054 D60G probably benign Het
Wiz G A 17: 32,359,165 P449S probably benign Het
Zic1 A G 9: 91,364,732 S96P probably damaging Het
Zw10 T A 9: 49,069,712 S471T probably benign Het
Other mutations in Rubcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Rubcn APN 16 32824377 critical splice donor site probably null
IGL00777:Rubcn APN 16 32836563 missense probably damaging 0.98
IGL01402:Rubcn APN 16 32827296 missense probably damaging 1.00
IGL01404:Rubcn APN 16 32827296 missense probably damaging 1.00
IGL02255:Rubcn APN 16 32827345 missense probably benign 0.04
IGL03019:Rubcn APN 16 32826707 missense probably damaging 0.98
IGL03388:Rubcn APN 16 32841568 missense probably benign 0.02
R0254:Rubcn UTSW 16 32847946 missense probably benign 0.00
R0373:Rubcn UTSW 16 32835980 missense probably damaging 1.00
R0636:Rubcn UTSW 16 32828686 missense probably damaging 1.00
R0839:Rubcn UTSW 16 32827343 missense probably damaging 0.98
R0967:Rubcn UTSW 16 32825717 missense probably benign 0.00
R1711:Rubcn UTSW 16 32843101 missense probably damaging 1.00
R1819:Rubcn UTSW 16 32826914 missense possibly damaging 0.93
R1840:Rubcn UTSW 16 32826172 missense possibly damaging 0.83
R2511:Rubcn UTSW 16 32847254 missense probably damaging 1.00
R3932:Rubcn UTSW 16 32829259 splice site probably null
R3933:Rubcn UTSW 16 32829259 splice site probably null
R4384:Rubcn UTSW 16 32856902 missense probably damaging 0.96
R4788:Rubcn UTSW 16 32836408 critical splice donor site probably null
R4852:Rubcn UTSW 16 32843308 missense probably damaging 1.00
R4921:Rubcn UTSW 16 32847294 missense probably damaging 1.00
R4950:Rubcn UTSW 16 32843193 missense probably damaging 1.00
R5234:Rubcn UTSW 16 32836458 missense probably damaging 1.00
R5527:Rubcn UTSW 16 32826711 missense probably damaging 1.00
R5616:Rubcn UTSW 16 32826923 missense possibly damaging 0.76
R5823:Rubcn UTSW 16 32849721 missense probably damaging 0.98
R6970:Rubcn UTSW 16 32868144 intron probably benign
R7120:Rubcn UTSW 16 32836469 missense probably damaging 1.00
R7121:Rubcn UTSW 16 32836469 missense probably damaging 1.00
R7833:Rubcn UTSW 16 32868274 start gained probably benign
X0065:Rubcn UTSW 16 32847985 missense possibly damaging 0.85
Z1176:Rubcn UTSW 16 32843163 missense probably benign 0.00
Z1177:Rubcn UTSW 16 32825589 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATCTGACCCAGTCCGCTC -3'
(R):5'- CATCTTAAGAGGATGCAGGAGC -3'

Sequencing Primer
(F):5'- GCTCCACATGAAACAGTACAGG -3'
(R):5'- TAGTACAATGATGGTCTCCAGAGC -3'
Posted On2019-09-05