Mutagenetix > Incidental Mutations

Incidental Mutation 'R7189:Lama4'

568656

Institutional Source

Beutler Lab

Gene Symbol

Lama4

Ensembl Gene

ENSMUSG00000019846

Gene Name

laminin, alpha 4

Synonyms

laminin [a]4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7189 (G1)

Quality Score

43.0073

Status

Validated

Chromosome

Chromosomal Location

38965515-39110188 bp(+) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

G to A at 38965733 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000019992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019992]

AlphaFold

P97927

Predicted Effect

probably benign
Transcript: ENSMUST00000019992

SMART Domains

Protein: ENSMUSP00000019992
Gene: ENSMUSG00000019846

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
EGF_Lam	82	129	1.95e-8	SMART
EGF_Lam	132	184	5.78e-11	SMART
EGF_Lam	187	238	9.83e-14	SMART
Pfam:Laminin_I	283	548	5.3e-71	PFAM
coiled coil region	658	685	N/A	INTRINSIC
LamG	850	1009	9.54e-11	SMART
LamG	1066	1205	5.9e-25	SMART
LamG	1250	1374	6.68e-24	SMART
LamG	1484	1619	1.54e-37	SMART
LamG	1661	1794	3.63e-34	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

95% (57/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the alpha chain isoform laminin, alpha 4. The domain structure of alpha 4 is similar to that of alpha 3, both of which resemble truncated versions of alpha 1 and alpha 2, in that approximately 1,200 residues at the N-terminus (domains IV, V and VI) have been lost. Laminin, alpha 4 contains the C-terminal G domain which distinguishes all alpha chains from the beta and gamma chains. The RNA analysis from adult and fetal tissues revealed developmental regulation of expression, however, the exact function of laminin, alpha 4 is not known. Tissue-specific utilization of alternative polyA-signal has been described in literature. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired motor control of the hind limbs associated with improperly positioned synaptic active zones and junctional folds, and prenatal and neonatal hemorrhages associated with capillary defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	G	T	2: 103,567,516	A264S	probably benign	Het
Atr	G	T	9: 95,862,791	E54*	probably null	Het
Bmp4	A	G	14: 46,383,999	S363P	probably damaging	Het
Cfap54	C	A	10: 92,937,728	A2077S	unknown	Het
Chrna7	T	C	7: 63,106,027	D257G	probably damaging	Het
Chrnd	C	T	1: 87,191,058	R46W	probably damaging	Het
Cntn2	A	G	1: 132,517,086	I851T	probably damaging	Het
Col3a1	T	A	1: 45,333,657	I534K	unknown	Het
Cyp3a25	A	T	5: 146,003,060	L46I	probably benign	Het
Dnah7b	G	C	1: 46,242,142	G2788R	probably damaging	Het
Dnpep	T	C	1: 75,313,430	E301G	probably damaging	Het
Efcab3	T	C	11: 105,095,864	S30P	probably benign	Het
Elk4	A	G	1: 132,019,389	I373V	probably damaging	Het
Fam161b	T	C	12: 84,348,646	S508G	probably damaging	Het
Fam198b	T	A	3: 79,886,807	L194*	probably null	Het
Fam214a	T	C	9: 75,004,351	C42R	probably damaging	Het
Fam71d	C	T	12: 78,712,208	P101S	probably benign	Het
Fgf10	A	G	13: 118,789,123	E146G	probably benign	Het
Fsip2	A	G	2: 82,993,237	D6438G	possibly damaging	Het
Gm3139	T	A	5: 94,537,751	Y423*	probably null	Het
Gm49355	T	A	14: 12,296,672	C10*	probably null	Het
Hfm1	A	G	5: 106,901,703		probably null	Het
Hivep3	T	C	4: 120,132,219	S1956P	probably damaging	Het
Hrh2	A	G	13: 54,221,251	S369G	unknown	Het
Hspg2	T	C	4: 137,533,561		probably null	Het
Hsph1	T	C	5: 149,630,460	Y181C	probably damaging	Het
Kcnh8	A	G	17: 52,894,117		probably null	Het
Kctd1	C	T	18: 15,062,643	E308K	possibly damaging	Het
Kdm8	A	T	7: 125,460,931	Y335F	probably damaging	Het
Kif2b	C	G	11: 91,577,137	G107R	probably benign	Het
Lepr	T	C	4: 101,814,764	V995A	probably benign	Het
Mfsd4a	A	T	1: 132,052,393	V375E	probably damaging	Het
Mgl2	G	T	11: 70,137,043	W359L	probably damaging	Het
Muc5b	C	A	7: 141,861,061	Y2581*	probably null	Het
Nol10	G	T	12: 17,373,561		probably null	Het
Olfr1297	T	A	2: 111,621,193	M294L	probably benign	Het
Olfr665	A	T	7: 104,881,141	K145*	probably null	Het
Otud3	C	T	4: 138,909,554	V99M	probably damaging	Het
Parvb	T	C	15: 84,303,471		probably null	Het
Pclo	C	A	5: 14,521,918	P439Q	possibly damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Pkn1	A	T	8: 83,692,673	H100Q	possibly damaging	Het
Plce1	A	T	19: 38,760,137	I1771F	probably damaging	Het
Plxna2	G	T	1: 194,801,058	R1559L	possibly damaging	Het
Ppp2r3a	T	A	9: 101,126,422	I416L	possibly damaging	Het
Robo1	C	A	16: 72,960,151	C333*	probably null	Het
Ryr2	A	T	13: 11,883,123	Y129N	probably damaging	Het
Schip1	A	T	3: 68,617,699	K359M	probably damaging	Het
Schip1	G	T	3: 68,617,700	K359N	probably damaging	Het
Sh2d2a	T	A	3: 87,848,361	S65T	possibly damaging	Het
Ssrp1	G	A	2: 85,045,562	M588I	probably benign	Het
Stim2	T	A	5: 54,116,128	C567S	probably benign	Het
Syne1	C	A	10: 5,424,295	A171S	probably benign	Het
Tigd3	A	G	19: 5,893,022	S27P	probably benign	Het
Vipr1	C	A	9: 121,664,554	Q224K	probably damaging	Het
Vmn1r75	T	A	7: 11,880,548	M69K	possibly damaging	Het
Vmn2r72	T	G	7: 85,754,917	D22A	probably benign	Het
Zbtb24	G	A	10: 41,464,476	V523I	probably benign	Het
Zbtb43	A	G	2: 33,462,295	F20S	probably benign	Het

Other mutations in Lama4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Lama4	APN	10	39065595	splice site	probably benign
IGL00091:Lama4	APN	10	39072805	missense	probably damaging	1.00
IGL00429:Lama4	APN	10	39011026	missense	possibly damaging	0.58
IGL00430:Lama4	APN	10	39045704	missense	possibly damaging	0.54
IGL01074:Lama4	APN	10	39098488	critical splice donor site	probably null
IGL01386:Lama4	APN	10	39011064	missense	probably benign	0.00
IGL01603:Lama4	APN	10	39065646	missense	possibly damaging	0.92
IGL01643:Lama4	APN	10	39056850	missense	probably benign
IGL01655:Lama4	APN	10	39060213	missense	probably benign
IGL01954:Lama4	APN	10	39087299	missense	probably benign	0.05
IGL01984:Lama4	APN	10	39075529	critical splice donor site	probably null
IGL02193:Lama4	APN	10	39042674	missense	probably benign
IGL02290:Lama4	APN	10	39017364	missense	probably benign	0.00
IGL02441:Lama4	APN	10	39061445	missense	probably benign	0.20
IGL02549:Lama4	APN	10	39060204	missense	probably benign	0.00
IGL02797:Lama4	APN	10	39056924	missense	probably null	0.00
IGL02819:Lama4	APN	10	39026569	missense	possibly damaging	0.80
IGL03122:Lama4	APN	10	39067963	missense	probably benign
IGL03184:Lama4	APN	10	39078843	missense	probably damaging	1.00
IGL03307:Lama4	APN	10	39017383	missense	probably benign
BB006:Lama4	UTSW	10	39078847	missense	probably damaging	1.00
BB016:Lama4	UTSW	10	39078847	missense	probably damaging	1.00
PIT4585001:Lama4	UTSW	10	39074746	missense	probably damaging	1.00
R0003:Lama4	UTSW	10	39060222	missense	possibly damaging	0.55
R0015:Lama4	UTSW	10	39075436	missense	possibly damaging	0.87
R0015:Lama4	UTSW	10	39075436	missense	possibly damaging	0.87
R0035:Lama4	UTSW	10	39072738	missense	probably benign	0.01
R0141:Lama4	UTSW	10	39092278	missense	probably benign	0.05
R0257:Lama4	UTSW	10	39094884	splice site	probably benign
R0267:Lama4	UTSW	10	39028639	missense	probably damaging	0.96
R0557:Lama4	UTSW	10	39088397	missense	probably benign	0.38
R1052:Lama4	UTSW	10	39092245	missense	possibly damaging	0.68
R1248:Lama4	UTSW	10	39056847	missense	probably damaging	0.99
R1249:Lama4	UTSW	10	39075478	missense	probably damaging	1.00
R1291:Lama4	UTSW	10	39048069	missense	probably benign	0.00
R1307:Lama4	UTSW	10	39070032	missense	probably benign	0.06
R1404:Lama4	UTSW	10	39061391	missense	probably benign	0.09
R1404:Lama4	UTSW	10	39061391	missense	probably benign	0.09
R1443:Lama4	UTSW	10	39073643	missense	probably damaging	1.00
R1499:Lama4	UTSW	10	39088880	missense	possibly damaging	0.92
R1616:Lama4	UTSW	10	39075450	missense	probably damaging	1.00
R1691:Lama4	UTSW	10	39080563	missense	probably benign	0.09
R1748:Lama4	UTSW	10	39065619	missense	probably benign	0.01
R1768:Lama4	UTSW	10	39103501	missense	possibly damaging	0.82
R1772:Lama4	UTSW	10	39060224	missense	probably benign	0.00
R1813:Lama4	UTSW	10	39033125	splice site	probably benign
R1813:Lama4	UTSW	10	39060186	missense	probably damaging	1.00
R1897:Lama4	UTSW	10	39060186	missense	probably damaging	1.00
R1907:Lama4	UTSW	10	39072758	missense	probably benign	0.13
R1943:Lama4	UTSW	10	39097138	missense	possibly damaging	0.85
R2041:Lama4	UTSW	10	39069991	missense	probably damaging	1.00
R2242:Lama4	UTSW	10	39026693	missense	probably damaging	1.00
R2300:Lama4	UTSW	10	39087320	missense	probably benign
R2326:Lama4	UTSW	10	39042567	splice site	probably null
R2570:Lama4	UTSW	10	39075358	missense	possibly damaging	0.94
R2570:Lama4	UTSW	10	39106047	missense	probably damaging	1.00
R2571:Lama4	UTSW	10	39042675	missense	possibly damaging	0.55
R2887:Lama4	UTSW	10	39092254	missense	possibly damaging	0.94
R2926:Lama4	UTSW	10	39078832	missense	probably benign	0.16
R3237:Lama4	UTSW	10	39097179	missense	probably damaging	0.97
R4095:Lama4	UTSW	10	39097122	missense	probably damaging	1.00
R4151:Lama4	UTSW	10	39005428	missense	probably benign	0.00
R4470:Lama4	UTSW	10	39080496	nonsense	probably null
R4812:Lama4	UTSW	10	39072769	missense	probably benign
R4822:Lama4	UTSW	10	39033053	missense	probably benign	0.01
R4997:Lama4	UTSW	10	39092266	missense	probably damaging	0.99
R5119:Lama4	UTSW	10	39048054	missense	probably benign	0.00
R5468:Lama4	UTSW	10	39072682	splice site	probably null
R5909:Lama4	UTSW	10	39072859	missense	probably benign	0.00
R5917:Lama4	UTSW	10	39048032	missense	probably benign	0.10
R5927:Lama4	UTSW	10	39072812	missense	probably damaging	1.00
R5950:Lama4	UTSW	10	39030448	missense	probably benign	0.03
R6051:Lama4	UTSW	10	39067902	missense	probably benign	0.01
R6277:Lama4	UTSW	10	39106010	missense	probably damaging	1.00
R6294:Lama4	UTSW	10	39075470	missense	probably damaging	1.00
R6372:Lama4	UTSW	10	39067952	missense	probably benign
R6532:Lama4	UTSW	10	39048077	missense	possibly damaging	0.58
R6547:Lama4	UTSW	10	39073656	missense	probably damaging	1.00
R6578:Lama4	UTSW	10	39017365	missense	probably benign	0.01
R6737:Lama4	UTSW	10	39094911	missense	probably damaging	0.96
R6987:Lama4	UTSW	10	39074279	missense	probably benign	0.00
R7040:Lama4	UTSW	10	39060162	missense	possibly damaging	0.69
R7139:Lama4	UTSW	10	39075495	missense	probably damaging	1.00
R7188:Lama4	UTSW	10	38965733	start gained	probably benign
R7199:Lama4	UTSW	10	39080540	missense	possibly damaging	0.84
R7211:Lama4	UTSW	10	39005495	missense	probably damaging	0.98
R7262:Lama4	UTSW	10	39094934	missense	probably damaging	1.00
R7274:Lama4	UTSW	10	39092299	missense	probably benign	0.00
R7311:Lama4	UTSW	10	39026635	missense	probably damaging	1.00
R7391:Lama4	UTSW	10	39087387	critical splice donor site	probably null
R7399:Lama4	UTSW	10	39047948	missense	probably damaging	0.98
R7426:Lama4	UTSW	10	39045755	missense	possibly damaging	0.82
R7472:Lama4	UTSW	10	39087373	missense	possibly damaging	0.65
R7635:Lama4	UTSW	10	39092188	missense	probably benign
R7775:Lama4	UTSW	10	39078847	missense	probably damaging	1.00
R7805:Lama4	UTSW	10	39026751	critical splice donor site	probably null
R7885:Lama4	UTSW	10	39088844	missense	probably benign	0.01
R7895:Lama4	UTSW	10	39088329	missense	probably damaging	0.96
R7910:Lama4	UTSW	10	39070009	missense	probably damaging	0.99
R7929:Lama4	UTSW	10	39078847	missense	probably damaging	1.00
R7952:Lama4	UTSW	10	39030490	missense	probably benign	0.39
R7991:Lama4	UTSW	10	39045809	missense	possibly damaging	0.70
R8059:Lama4	UTSW	10	38966061	missense	probably benign	0.00
R8194:Lama4	UTSW	10	39078720	missense	probably damaging	0.99
R8248:Lama4	UTSW	10	39061379	missense	possibly damaging	0.82
R8252:Lama4	UTSW	10	39060146	missense	probably benign	0.00
R8265:Lama4	UTSW	10	39105204	missense	probably damaging	1.00
R8275:Lama4	UTSW	10	39072811	missense	probably damaging	1.00
R8426:Lama4	UTSW	10	39103491	missense	probably damaging	0.98
R8434:Lama4	UTSW	10	39026707	missense	possibly damaging	0.92
R8720:Lama4	UTSW	10	39095083	missense	probably damaging	0.97
R8792:Lama4	UTSW	10	39048052	missense	probably benign	0.00
R8836:Lama4	UTSW	10	39026591	missense	probably damaging	1.00
R8867:Lama4	UTSW	10	39048000	missense	probably damaging	1.00
R8892:Lama4	UTSW	10	39097198	missense	probably damaging	1.00
R8913:Lama4	UTSW	10	39106043	missense	probably benign	0.10
R9129:Lama4	UTSW	10	39056891	missense	probably benign
R9177:Lama4	UTSW	10	39074692	missense	probably damaging	0.98
R9187:Lama4	UTSW	10	39048128	critical splice donor site	probably null
R9193:Lama4	UTSW	10	39075448	missense	probably benign	0.03
R9268:Lama4	UTSW	10	39074692	missense	probably damaging	0.98
R9287:Lama4	UTSW	10	39105964	missense	probably damaging	1.00
R9295:Lama4	UTSW	10	39072751	missense	probably damaging	1.00
R9303:Lama4	UTSW	10	39097141	missense	probably damaging	0.99
R9330:Lama4	UTSW	10	39078726	missense	probably damaging	0.99
R9430:Lama4	UTSW	10	39045806	missense	probably null
X0067:Lama4	UTSW	10	39045692	missense	probably benign	0.00
Z1177:Lama4	UTSW	10	39005424	nonsense	probably null
Z1177:Lama4	UTSW	10	39005425	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGTCTGAAAGCCAACTTGAAG -3'
(R):5'- TTCCTGGAGTGAAGGACCTG -3'

Sequencing Primer
(F):5'- CAACTTGAAGTGGGAGGGCC -3'
(R):5'- CCTGGAGGTCTTGGTGGGTAC -3'

Posted On

2019-09-06