Incidental Mutation 'R7196:Pcnx'
ID568660
Institutional Source Beutler Lab
Gene Symbol Pcnx
Ensembl Gene ENSMUSG00000021140
Gene Namepecanex homolog
Synonyms3526401J03Rik, 2900024E21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7196 (G1)
Quality Score203.009
Status Validated
Chromosome12
Chromosomal Location81860023-82000924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81995538 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 34 (R34H)
Ref Sequence ENSEMBL: ENSMUSP00000152168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005] [ENSMUST00000222468]
Predicted Effect probably benign
Transcript: ENSMUST00000021567
SMART Domains Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
low complexity region 616 638 N/A INTRINSIC
low complexity region 672 692 N/A INTRINSIC
low complexity region 764 783 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
transmembrane domain 1006 1028 N/A INTRINSIC
transmembrane domain 1035 1052 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1113 1135 N/A INTRINSIC
transmembrane domain 1163 1185 N/A INTRINSIC
transmembrane domain 1197 1216 N/A INTRINSIC
transmembrane domain 1269 1291 N/A INTRINSIC
transmembrane domain 1298 1315 N/A INTRINSIC
Pfam:Pecanex_C 1785 2011 1.6e-118 PFAM
low complexity region 2125 2140 N/A INTRINSIC
low complexity region 2195 2202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221675
Predicted Effect probably benign
Transcript: ENSMUST00000221721
Predicted Effect probably benign
Transcript: ENSMUST00000222005
Predicted Effect possibly damaging
Transcript: ENSMUST00000222468
AA Change: R34H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,258,222 probably null Het
4921504E06Rik A C 2: 19,493,995 S396A probably benign Het
Actr6 C A 10: 89,714,922 V337F possibly damaging Het
Agtpbp1 T C 13: 59,533,180 T73A possibly damaging Het
AI182371 A T 2: 35,086,429 probably null Het
Apob A G 12: 7,983,893 E202G possibly damaging Het
Asb4 A T 6: 5,423,356 M168L probably benign Het
AU018091 T C 7: 3,163,958 Y152C probably damaging Het
Casp3 G A 8: 46,635,463 G132R possibly damaging Het
Cbfa2t3 C A 8: 122,638,990 A229S probably benign Het
Cdh23 A T 10: 60,307,980 Y2949N probably damaging Het
Ceacam3 T C 7: 17,154,956 Y217H Het
Cldn5 A T 16: 18,776,880 probably benign Het
Cltc T C 11: 86,706,831 D1093G probably damaging Het
Cnn3 G A 3: 121,454,788 probably null Het
Col4a2 A G 8: 11,398,693 Y71C probably damaging Het
Csf1 T C 3: 107,753,898 D77G possibly damaging Het
Cyp2j7 T A 4: 96,215,414 T295S probably benign Het
Dnah7a A T 1: 53,684,841 M133K probably benign Het
Dock5 G A 14: 67,756,470 P1852L probably damaging Het
Dpysl3 T A 18: 43,329,845 D489V probably damaging Het
Dsg4 T C 18: 20,466,480 Y718H probably damaging Het
Dync2h1 G A 9: 7,147,715 Q972* probably null Het
Epn1 G A 7: 5,093,381 D225N possibly damaging Het
Esp4 A G 17: 40,602,365 E41G probably benign Het
Fam171a2 T C 11: 102,438,346 D529G probably benign Het
Fbxl13 A T 5: 21,486,303 I694N probably damaging Het
Fshr C T 17: 88,985,469 A594T probably damaging Het
Galnt3 A G 2: 66,090,924 Y533H probably damaging Het
Gja5 C A 3: 97,051,106 R160S probably damaging Het
Gm12353 A T 4: 19,608,938 D7V unknown Het
Gm17669 T C 18: 67,562,502 F39S probably damaging Het
Gm7145 T A 1: 117,986,061 N224K possibly damaging Het
Gpd1 G T 15: 99,722,055 G245C probably benign Het
Gpr4 G A 7: 19,223,164 G337D probably benign Het
Hgd G A 16: 37,588,716 C14Y probably benign Het
Ibtk A T 9: 85,743,656 S14T probably damaging Het
Ifi205 G T 1: 174,026,543 N181K probably damaging Het
Inppl1 G A 7: 101,828,786 A673V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Jrkl G T 9: 13,244,157 P500T probably benign Het
Kcnq1 G A 7: 143,358,741 V515I possibly damaging Het
Kifc3 A G 8: 95,106,611 V453A probably benign Het
Krt10 C T 11: 99,387,545 E263K probably damaging Het
Lingo1 A T 9: 56,620,619 F235I probably damaging Het
Lmo7 T A 14: 101,896,500 D660E possibly damaging Het
Magi3 A C 3: 104,049,168 C661W probably benign Het
Mmp1a C T 9: 7,476,017 Q428* probably null Het
Msrb1 A T 17: 24,739,582 T47S probably benign Het
Naip6 A T 13: 100,300,158 I619K probably benign Het
Ndfip2 T C 14: 105,298,038 S253P probably damaging Het
Nebl A T 2: 17,452,518 V77E probably damaging Het
Nit1 T C 1: 171,344,435 E65G probably benign Het
Ntn4 C T 10: 93,733,714 H430Y probably benign Het
Nxpe5 A T 5: 138,239,324 I49F probably benign Het
Olfr1299 T G 2: 111,664,697 L157W probably damaging Het
Olfr18 A G 9: 20,314,198 Y241H probably benign Het
Olfr24 A T 9: 18,755,590 L15* probably null Het
Olfr310 A T 7: 86,269,441 M116K probably damaging Het
Olfr382 A G 11: 73,517,131 Y23H probably benign Het
Olfr605 A T 7: 103,442,997 M42K probably benign Het
Olfr714 A G 7: 107,074,728 N300S probably benign Het
Olfr95 A G 17: 37,211,193 I220T probably damaging Het
Oxct2a T A 4: 123,323,372 N72I probably damaging Het
Pappa G A 4: 65,323,891 probably null Het
Plekha5 G T 6: 140,543,922 V236L possibly damaging Het
Prdm1 A G 10: 44,456,992 S44P probably benign Het
Prss46 T A 9: 110,851,465 L226Q probably benign Het
Prss47 C A 13: 65,044,826 W380C probably benign Het
Ptch2 T G 4: 117,114,749 V1156G probably benign Het
Rab3gap2 T C 1: 185,281,667 F1190S probably damaging Het
Raver2 T G 4: 101,102,859 Y179D probably damaging Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Ripor2 T G 13: 24,704,825 I629S possibly damaging Het
Robo4 T A 9: 37,402,705 M84K possibly damaging Het
Rps6ka5 A T 12: 100,595,864 S252T possibly damaging Het
Rtl1 C T 12: 109,592,787 V873M possibly damaging Het
Sla T A 15: 66,831,571 R4W probably benign Het
Smco1 A G 16: 32,273,802 D97G probably damaging Het
Srgap1 T C 10: 121,840,848 T414A probably benign Het
Syt14 A G 1: 193,035,628 I3T probably benign Het
Tnpo2 G A 8: 85,047,137 V303M possibly damaging Het
Tstd2 A C 4: 46,119,955 S332R probably damaging Het
Ttn C A 2: 76,752,042 A22836S possibly damaging Het
Ufl1 A G 4: 25,250,669 V728A probably benign Het
Usp33 A T 3: 152,384,191 K789N possibly damaging Het
Usp54 T A 14: 20,588,370 Q214L probably damaging Het
Vmn2r7 T G 3: 64,715,777 N374T probably benign Het
Zbtb7a T A 10: 81,144,600 N209K probably damaging Het
Zc3hav1 A G 6: 38,329,272 V615A probably benign Het
Zdhhc20 A G 14: 57,873,891 probably null Het
Zfp90 G T 8: 106,425,148 V498L probably damaging Het
Other mutations in Pcnx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pcnx APN 12 81895101 missense probably damaging 0.98
IGL00561:Pcnx APN 12 81996053 missense probably damaging 1.00
IGL01066:Pcnx APN 12 81992021 missense possibly damaging 0.87
IGL01069:Pcnx APN 12 81918144 missense probably benign 0.27
IGL01082:Pcnx APN 12 81990598 missense possibly damaging 0.62
IGL01087:Pcnx APN 12 81995339 splice site probably benign
IGL01145:Pcnx APN 12 81992035 missense probably damaging 0.99
IGL01412:Pcnx APN 12 81906465 missense probably damaging 1.00
IGL01477:Pcnx APN 12 81973241 missense probably damaging 0.98
IGL01639:Pcnx APN 12 81950320 critical splice donor site probably null
IGL01815:Pcnx APN 12 81990551 missense probably damaging 1.00
IGL01870:Pcnx APN 12 81975893 missense probably benign 0.01
IGL01902:Pcnx APN 12 81979094 missense probably damaging 1.00
IGL01935:Pcnx APN 12 81917816 missense probably benign 0.00
IGL02141:Pcnx APN 12 81860382 missense possibly damaging 0.86
IGL02179:Pcnx APN 12 81933719 intron probably benign
IGL02197:Pcnx APN 12 81919104 missense probably benign 0.01
IGL02197:Pcnx APN 12 81993151 missense possibly damaging 0.85
IGL02238:Pcnx APN 12 81917914 missense probably damaging 1.00
IGL02430:Pcnx APN 12 81919322 missense possibly damaging 0.89
IGL02590:Pcnx APN 12 81994978 missense probably damaging 1.00
IGL02992:Pcnx APN 12 81964120 missense probably damaging 1.00
IGL03304:Pcnx APN 12 81982029 missense probably damaging 1.00
PIT4515001:Pcnx UTSW 12 81991787 missense
R0086:Pcnx UTSW 12 81992058 unclassified probably benign
R0114:Pcnx UTSW 12 81996095 missense possibly damaging 0.95
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0240:Pcnx UTSW 12 81947018 missense possibly damaging 0.67
R0376:Pcnx UTSW 12 81974579 splice site probably benign
R0377:Pcnx UTSW 12 81974579 splice site probably benign
R0416:Pcnx UTSW 12 81974466 missense probably benign 0.09
R0514:Pcnx UTSW 12 81995110 missense probably benign 0.21
R0563:Pcnx UTSW 12 81917944 missense probably damaging 1.00
R0569:Pcnx UTSW 12 81992030 missense probably benign 0.08
R0626:Pcnx UTSW 12 81983676 missense possibly damaging 0.82
R0972:Pcnx UTSW 12 81913412 missense probably damaging 1.00
R1205:Pcnx UTSW 12 81956243 missense probably damaging 1.00
R1455:Pcnx UTSW 12 81973234 missense probably damaging 1.00
R1514:Pcnx UTSW 12 81918798 missense probably damaging 1.00
R1731:Pcnx UTSW 12 81990704 missense probably damaging 1.00
R1758:Pcnx UTSW 12 81983484 missense probably benign 0.27
R1774:Pcnx UTSW 12 81975320 missense probably damaging 1.00
R1817:Pcnx UTSW 12 81918642 missense probably benign
R1843:Pcnx UTSW 12 81980935 missense probably damaging 1.00
R1862:Pcnx UTSW 12 81918732 missense probably damaging 1.00
R2042:Pcnx UTSW 12 81918293 missense probably damaging 1.00
R2054:Pcnx UTSW 12 81933674 missense probably benign 0.02
R2243:Pcnx UTSW 12 81918705 missense probably damaging 1.00
R2272:Pcnx UTSW 12 81995314 missense probably benign 0.26
R2360:Pcnx UTSW 12 81950186 missense probably damaging 0.99
R2926:Pcnx UTSW 12 81994995 missense probably damaging 1.00
R3607:Pcnx UTSW 12 81928292 missense probably damaging 1.00
R3781:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3782:Pcnx UTSW 12 81996118 missense probably benign 0.00
R3806:Pcnx UTSW 12 81950137 missense possibly damaging 0.84
R3926:Pcnx UTSW 12 81958731 missense probably damaging 1.00
R4019:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4020:Pcnx UTSW 12 81918244 missense probably damaging 1.00
R4683:Pcnx UTSW 12 81986672 missense probably benign 0.01
R4703:Pcnx UTSW 12 81895164 missense probably benign 0.01
R4732:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4733:Pcnx UTSW 12 81995751 missense probably benign 0.01
R4755:Pcnx UTSW 12 81950294 missense probably damaging 1.00
R4792:Pcnx UTSW 12 81919151 missense probably damaging 1.00
R4897:Pcnx UTSW 12 81918165 missense probably damaging 1.00
R4915:Pcnx UTSW 12 81974495 missense probably benign 0.10
R4934:Pcnx UTSW 12 81991825 missense possibly damaging 0.76
R4940:Pcnx UTSW 12 81917793 missense possibly damaging 0.60
R5079:Pcnx UTSW 12 81979089 nonsense probably null
R5087:Pcnx UTSW 12 81994939 missense probably damaging 1.00
R5284:Pcnx UTSW 12 81919029 missense probably benign 0.02
R5287:Pcnx UTSW 12 81982051 missense probably damaging 1.00
R5436:Pcnx UTSW 12 81860406 missense probably damaging 1.00
R5505:Pcnx UTSW 12 81950153 missense probably damaging 1.00
R5538:Pcnx UTSW 12 81860409 missense probably damaging 1.00
R5632:Pcnx UTSW 12 81917730 missense probably damaging 1.00
R5642:Pcnx UTSW 12 81895029 missense possibly damaging 0.45
R5841:Pcnx UTSW 12 81918655 missense possibly damaging 0.62
R6275:Pcnx UTSW 12 81918607 missense probably benign 0.34
R6508:Pcnx UTSW 12 81912705 missense probably damaging 0.98
R6532:Pcnx UTSW 12 81980964 missense probably damaging 1.00
R6634:Pcnx UTSW 12 81917882 nonsense probably null
R6753:Pcnx UTSW 12 81964480 missense probably damaging 1.00
R6776:Pcnx UTSW 12 81962722 missense possibly damaging 0.81
R6778:Pcnx UTSW 12 81918871 missense probably damaging 1.00
R6890:Pcnx UTSW 12 81971376 missense probably benign 0.09
R6894:Pcnx UTSW 12 81987973 missense probably damaging 1.00
R6927:Pcnx UTSW 12 81917812 missense probably benign 0.37
R7173:Pcnx UTSW 12 81953003 intron probably null
R7316:Pcnx UTSW 12 81995549 missense probably benign 0.16
R7559:Pcnx UTSW 12 81993122 missense unknown
R7635:Pcnx UTSW 12 81919125 missense
R7669:Pcnx UTSW 12 81990551 missense probably damaging 1.00
R8021:Pcnx UTSW 12 81918819 nonsense probably null
R8049:Pcnx UTSW 12 81918819 nonsense probably null
RF024:Pcnx UTSW 12 81917727 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918202 missense probably damaging 0.98
Z1177:Pcnx UTSW 12 81918677 missense
Predicted Primers PCR Primer
(F):5'- GTGATTTACAGAGTCCAGGTGAG -3'
(R):5'- ACACATGAGGATCACTGCCAG -3'

Sequencing Primer
(F):5'- ATTTACAGAGTCCAGGTGAGTAGGTC -3'
(R):5'- GAGGATCACTGCCAGCTCATTTC -3'
Posted On2019-09-06