Mutagenetix > Incidental Mutations

Incidental Mutation 'R7209:Rxfp2'

568663

Institutional Source

Beutler Lab

Gene Symbol

Rxfp2

Ensembl Gene

ENSMUSG00000053368

Gene Name

relaxin/insulin-like family peptide receptor 2

Synonyms

Gpr106, Great, LGR8

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7209 (G1)

Quality Score

103.008

Status

Validated

Chromosome

Chromosomal Location

150018675-150082184 bp(+) (GRCm38)

Type of Mutation

splice site (186 bp from exon)

DNA Base Change (assembly)

A to G at 150053098 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065745] [ENSMUST00000110496] [ENSMUST00000201612]

Predicted Effect

probably null
Transcript: ENSMUST00000065745

SMART Domains

Protein: ENSMUSP00000067897
Gene: ENSMUSG00000053368

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LDLa	27	65	2.55e-11	SMART
LRRNT	93	124	3.83e0	SMART
LRR	120	142	1.71e2	SMART
LRR	143	166	6.77e0	SMART
LRR_TYP	167	190	2.84e-5	SMART
LRR	191	214	7.36e0	SMART
LRR	215	238	1.26e1	SMART
LRR	239	262	2.61e1	SMART
LRR	263	286	8.98e1	SMART
LRR_TYP	287	310	2.24e-3	SMART
LRR	311	334	1.15e1	SMART
LRR	335	358	2.14e1	SMART
Pfam:7tm_1	415	674	1.4e-26	PFAM
low complexity region	682	695	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110496

SMART Domains

Protein: ENSMUSP00000106122
Gene: ENSMUSG00000053368

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LDLa	27	65	2.55e-11	SMART
LRRNT	93	124	3.83e0	SMART
LRR	120	142	1.71e2	SMART
LRR	143	166	6.77e0	SMART
LRR_TYP	167	190	2.84e-5	SMART
LRR	191	214	7.36e0	SMART
LRR	215	238	1.26e1	SMART
LRR	239	262	2.61e1	SMART
LRR	263	286	2.82e0	SMART
LRR	287	310	1.15e1	SMART
LRR	311	334	2.14e1	SMART
Pfam:7tm_1	391	650	1.5e-27	PFAM
low complexity region	658	671	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000201612

SMART Domains

Protein: ENSMUSP00000144536
Gene: ENSMUSG00000053368

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LDLa	27	65	1.3e-13	SMART
LRRNT	93	124	1.9e-2	SMART
LRR	120	142	7.4e-1	SMART
LRR	143	166	2.9e-2	SMART
LRR_TYP	167	190	1.2e-7	SMART
LRR	229	252	5.4e-2	SMART
LRR	253	276	1.1e-1	SMART
LRR	277	300	1.2e-2	SMART
LRR	301	324	5e-2	SMART
LRR	325	348	9.3e-2	SMART
Pfam:7tm_1	405	664	1.5e-24	PFAM
low complexity region	672	685	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GPCR (G protein-coupled, 7-transmembrane receptor) family. Mutations in this gene are associated with cryptorchidism. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit bilateral intraabdominal cryptorchidism and sterility associated with a failure in the differentiation of the gubernaculae, ligaments that control testicular movement during development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	C	A	1: 105,750,357	P1136T	probably damaging	Het
Adam7	A	G	14: 68,529,819	Y61H	probably damaging	Het
Adgrb1	T	G	15: 74,569,948	V966G	possibly damaging	Het
Adh5	G	A	3: 138,443,148		probably benign	Het
Akr1b8	T	C	6: 34,356,272	V28A	probably damaging	Het
Apbb1	T	A	7: 105,566,085	I450F	probably damaging	Het
Arhgap23	G	C	11: 97,492,447		probably null	Het
Arhgap23	C	T	11: 97,476,085	T1064I	probably damaging	Het
Atg4b	A	G	1: 93,775,233	I128M	probably damaging	Het
B230118H07Rik	T	C	2: 101,566,382	*217W	probably null	Het
Baat	A	T	4: 49,503,065	I19N	probably damaging	Het
Bspry	T	G	4: 62,486,615	I216S	possibly damaging	Het
Commd9	T	A	2: 101,895,138	S19T	possibly damaging	Het
Cr2	A	G	1: 195,168,724	C145R	probably damaging	Het
Cyp2c68	A	G	19: 39,689,205	L447P	probably damaging	Het
Depdc1b	T	C	13: 108,382,855	M333T	possibly damaging	Het
Dhx9	T	C	1: 153,464,623	T710A	possibly damaging	Het
Dnah5	T	C	15: 28,459,225	V4530A	possibly damaging	Het
Dohh	T	A	10: 81,386,040	H89Q	probably damaging	Het
Dopey2	T	A	16: 93,769,845	N1171K	probably benign	Het
Dscam	T	C	16: 96,650,344		probably null	Het
Entpd5	T	A	12: 84,396,928	S14C	probably benign	Het
Eqtn	G	A	4: 94,925,569	S125F	probably damaging	Het
Erp44	A	T	4: 48,211,704	D197E	probably benign	Het
Fgf18	A	T	11: 33,134,315	D46E	probably benign	Het
Foxa1	T	A	12: 57,543,291	M48L	probably benign	Het
Gabrg1	C	A	5: 70,754,170	C417F	probably damaging	Het
Glrp1	T	A	1: 88,503,282	Q122L	unknown	Het
Gm5286	A	T	3: 94,198,705	Q110L	probably benign	Het
Gm5622	A	G	14: 51,655,906	I97V	possibly damaging	Het
Gusb	A	G	5: 129,998,546	V306A	probably benign	Het
Hars	A	G	18: 36,773,540	S126P	probably benign	Het
Herc1	A	G	9: 66,385,032	S356G	possibly damaging	Het
Hydin	C	A	8: 110,489,792	Y1336*	probably null	Het
Kin	T	C	2: 10,091,753	Y138H	possibly damaging	Het
Lypd2	C	T	15: 74,732,417	V101M	probably benign	Het
Madcam1	A	T	10: 79,665,058	T70S	possibly damaging	Het
Man1a2	A	G	3: 100,647,079	C112R	unknown	Het
Mia2	T	A	12: 59,154,390	V198E	possibly damaging	Het
Mpdz	C	T	4: 81,306,877	V1438M	possibly damaging	Het
Mtif2	G	A	11: 29,529,996	V21M	probably benign	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nln	G	A	13: 104,072,898	Q56*	probably null	Het
Nlrp4b	T	C	7: 10,710,370	V82A	probably benign	Het
Obscn	C	A	11: 59,085,107	E2065*	probably null	Het
Olfr1510	A	G	14: 52,410,093	C260R	possibly damaging	Het
Pilrb2	C	T	5: 137,870,864		probably null	Het
Plekhh1	C	A	12: 79,050,376	D99E	probably benign	Het
Polr2b	T	A	5: 77,343,179	F956I	probably damaging	Het
Ppp3cc	A	G	14: 70,267,498	F20L	probably benign	Het
Prmt9	T	C	8: 77,564,998	V333A	probably benign	Het
Psd4	T	C	2: 24,397,345	S430P	probably damaging	Het
Rrp12	A	C	19: 41,872,949	V973G	possibly damaging	Het
S100a6	G	A	3: 90,613,788	A8T	possibly damaging	Het
Sgsm2	C	A	11: 74,854,325	G717V	probably damaging	Het
Sipa1	A	G	19: 5,654,975	Y531H	probably damaging	Het
Slc45a1	A	C	4: 150,635,212		probably null	Het
Srbd1	C	A	17: 86,001,520	L743F	probably damaging	Het
Taar2	A	T	10: 23,940,699	I46F	possibly damaging	Het
Tcrg-C3	A	G	13: 19,261,164	N94S	probably benign	Het
Tmem241	A	T	18: 12,104,172	V69D	probably damaging	Het
Tns1	T	C	1: 73,953,915	S535G	possibly damaging	Het
Ttc34	C	A	4: 154,839,128	P98Q	probably damaging	Het
Ubr1	C	A	2: 120,862,765	R1720L	probably benign	Het
Ubr3	T	A	2: 70,016,134	D1597E	probably benign	Het
Unc79	T	C	12: 103,125,624	M1930T	probably benign	Het
Vmn2r100	A	T	17: 19,531,314	I603F	not run	Het
Vps26b	A	T	9: 27,009,992	S304T	probably benign	Het
Zfp952	A	T	17: 33,003,470	T308S	possibly damaging	Het

Other mutations in Rxfp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00832:Rxfp2	APN	5	150066428	missense	probably benign
IGL00984:Rxfp2	APN	5	150067132	missense	probably benign	0.24
IGL02475:Rxfp2	APN	5	150063686	missense	probably benign	0.07
IGL02637:Rxfp2	APN	5	150055913	missense	probably damaging	0.99
IGL02992:Rxfp2	APN	5	150051556	missense	probably benign	0.01
IGL03052:Rxfp2	APN	5	150043180	splice site	probably benign
IGL03203:Rxfp2	APN	5	150063680	missense	probably benign	0.08
R0158:Rxfp2	UTSW	5	150051628	missense	probably benign	0.14
R0394:Rxfp2	UTSW	5	150067388	missense	probably benign	0.03
R0499:Rxfp2	UTSW	5	150066415	missense	probably damaging	1.00
R0576:Rxfp2	UTSW	5	150038247	missense	probably benign	0.01
R0720:Rxfp2	UTSW	5	150044119	missense	probably benign	0.04
R1172:Rxfp2	UTSW	5	150051556	missense	probably benign	0.01
R1173:Rxfp2	UTSW	5	150051556	missense	probably benign	0.01
R1174:Rxfp2	UTSW	5	150051556	missense	probably benign	0.01
R1175:Rxfp2	UTSW	5	150051556	missense	probably benign	0.01
R1606:Rxfp2	UTSW	5	150059897	missense	probably benign
R1720:Rxfp2	UTSW	5	150043099	nonsense	probably null
R2040:Rxfp2	UTSW	5	150070212	missense	probably benign
R3029:Rxfp2	UTSW	5	150043130	missense	probably benign	0.05
R3905:Rxfp2	UTSW	5	150055985	splice site	probably null
R4056:Rxfp2	UTSW	5	150051633	critical splice donor site	probably null
R4156:Rxfp2	UTSW	5	150051555	missense	probably benign	0.01
R4282:Rxfp2	UTSW	5	150070270	missense	possibly damaging	0.94
R4418:Rxfp2	UTSW	5	150048800	missense	probably benign
R4935:Rxfp2	UTSW	5	150051632	critical splice donor site	probably null
R5010:Rxfp2	UTSW	5	150067360	missense	probably damaging	1.00
R5286:Rxfp2	UTSW	5	150035444	missense	probably damaging	1.00
R5373:Rxfp2	UTSW	5	150070260	missense	probably benign	0.21
R5374:Rxfp2	UTSW	5	150070260	missense	probably benign	0.21
R5530:Rxfp2	UTSW	5	150056810	missense	probably damaging	1.00
R5844:Rxfp2	UTSW	5	150043124	missense	probably benign	0.00
R6021:Rxfp2	UTSW	5	150063737	missense	possibly damaging	0.46
R6211:Rxfp2	UTSW	5	150044126	splice site	probably null
R6401:Rxfp2	UTSW	5	150043130	missense	probably benign
R6841:Rxfp2	UTSW	5	150018745	start gained	probably benign
R6981:Rxfp2	UTSW	5	150048848	splice site	probably null
R7012:Rxfp2	UTSW	5	150081194	missense	probably benign	0.00
R7032:Rxfp2	UTSW	5	150070348	missense	probably damaging	1.00
R7151:Rxfp2	UTSW	5	150043107	missense	probably benign	0.01
R7205:Rxfp2	UTSW	5	150059899	missense	probably benign	0.05
R7205:Rxfp2	UTSW	5	150059903	missense	probably benign	0.00
R7468:Rxfp2	UTSW	5	150067336	missense	possibly damaging	0.70
R7475:Rxfp2	UTSW	5	150049581	missense	possibly damaging	0.94
R8181:Rxfp2	UTSW	5	150063736	missense	probably benign	0.22
R8258:Rxfp2	UTSW	5	150059900	missense	probably damaging	0.97
R8259:Rxfp2	UTSW	5	150059900	missense	probably damaging	0.97
R8443:Rxfp2	UTSW	5	150049603	missense	possibly damaging	0.45
X0067:Rxfp2	UTSW	5	150051618	missense	probably damaging	1.00
Z1177:Rxfp2	UTSW	5	150048810	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATTGAACCTGTTCTGTGCTAGG -3'
(R):5'- GCAAAGCCTTACATGTTTGGG -3'

Sequencing Primer
(F):5'- AACCTGTTCTGTGCTAGGAAGGAG -3'
(R):5'- CAAGTCTGTGTAGCATATGCCCG -3'

Posted On

2019-09-06