Incidental Mutation 'R7215:Klk1b3'
ID 568666
Institutional Source Beutler Lab
Gene Symbol Klk1b3
Ensembl Gene ENSMUSG00000066515
Gene Name kallikrein 1-related peptidase b3
Synonyms Ngfg, mGk-3, Ngfg
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7215 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 44198191-44202352 bp(+) (GRCm38)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to A at 44200404 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085450]
AlphaFold P00756
PDB Structure CRYSTAL STRUCTURE OF 7S NGF: A COMPLEX OF NERVE GROWTH FACTOR WITH FOUR BINDING PROTEINS (SERINE PROTEINASES) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000085450
SMART Domains Protein: ENSMUSP00000082577
Gene: ENSMUSG00000066515

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 8.28e-99 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the 7S nerve growth factor (NGF) complex that is essential for the differentiation and survival of distinct populations of neurons in both the central and the peripheral nervous systems. The encoded protein is a glandular kallikrein-type serine protease that processes the beta subunit of NGF. This gene is present in a cluster of multiple related kallikrein-type protease genes on chromosome 7. [provided by RefSeq, Jul 2015]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik G A 13: 77,323,571 V1032M possibly damaging Het
Abca13 T A 11: 9,288,405 probably null Het
Adamts14 T A 10: 61,211,596 H739L possibly damaging Het
Adgrl3 A G 5: 81,693,550 E758G probably damaging Het
Ano3 T A 2: 110,665,932 T826S probably damaging Het
Arhgap45 C T 10: 80,025,482 T493I possibly damaging Het
Atg9b A C 5: 24,388,041 W455G probably damaging Het
Atp4a A G 7: 30,717,360 N496S possibly damaging Het
Bckdk T A 7: 127,905,110 D60E possibly damaging Het
Blmh A T 11: 76,965,899 K244* probably null Het
Btbd17 T C 11: 114,791,465 I474V possibly damaging Het
C87436 A G 6: 86,462,680 E451G possibly damaging Het
Camta1 T C 4: 151,144,737 E546G probably damaging Het
Casp1 A G 9: 5,298,523 probably null Het
Ccdc114 C T 7: 45,936,622 R148C probably damaging Het
Ccdc116 A G 16: 17,139,928 Y456H probably damaging Het
Cep350 A C 1: 155,894,707 S1812R possibly damaging Het
Chrna10 A G 7: 102,112,208 L392P possibly damaging Het
Col22a1 A T 15: 71,970,332 C434* probably null Het
Cxcl9 G A 5: 92,323,888 Q98* probably null Het
Cyp2c54 G A 19: 40,046,182 T348I probably damaging Het
Dnah7a G A 1: 53,618,350 R756C probably damaging Het
Dnajc18 T C 18: 35,681,981 T239A probably benign Het
Dnase2a A T 8: 84,909,770 probably null Het
Dpyd A G 3: 119,266,032 T793A probably benign Het
E430018J23Rik A G 7: 127,391,523 S431P probably benign Het
Edil3 T C 13: 88,822,050 probably null Het
Ehd1 T A 19: 6,297,642 I342N possibly damaging Het
Erbb4 A T 1: 68,339,460 S341T probably benign Het
Ezh1 T A 11: 101,215,299 T87S probably benign Het
Fam20b A T 1: 156,690,553 W224R probably damaging Het
Galns A T 8: 122,599,348 probably null Het
Gm13283 C T 4: 88,760,730 probably benign Het
Gm15448 C T 7: 3,822,311 C444Y unknown Het
Gm49342 A T 14: 50,944,583 M23L probably benign Het
Gm5114 T A 7: 39,411,371 H18L probably benign Het
Gpr89 A G 3: 96,880,088 W299R probably damaging Het
Hadha G T 5: 30,119,842 N755K probably benign Het
Inpp5d A T 1: 87,701,218 H620L probably benign Het
Macf1 T C 4: 123,507,304 T663A probably damaging Het
Man1b1 A G 2: 25,350,390 N601S probably benign Het
Mbtps1 A G 8: 119,524,568 V605A possibly damaging Het
Med23 C G 10: 24,888,429 D311E probably benign Het
Myo3a G T 2: 22,245,567 D82Y possibly damaging Het
Nsd1 T A 13: 55,247,641 D1121E probably benign Het
Olfr1042 C T 2: 86,159,456 V305I probably benign Het
Olfr1221 G A 2: 89,112,501 Q4* probably null Het
Olfr918 A G 9: 38,673,447 I12T probably benign Het
Otoa T C 7: 121,118,572 V19A unknown Het
Pcdhb20 A T 18: 37,505,386 T322S probably benign Het
Pecam1 T C 11: 106,695,919 T257A probably benign Het
Pi16 G T 17: 29,319,098 probably benign Het
Pik3c2g C T 6: 139,754,863 T293M Het
Pkhd1l1 T A 15: 44,528,163 C1542S possibly damaging Het
Prrc2b G A 2: 32,229,297 G2172R probably damaging Het
Prrt1 A T 17: 34,629,703 probably null Het
Ptprb T A 10: 116,338,776 N784K possibly damaging Het
Rem1 C A 2: 152,628,149 S18R probably damaging Het
Ripk4 G A 16: 97,747,323 probably null Het
Scn8a G A 15: 101,029,830 V1397I possibly damaging Het
Setbp1 T A 18: 78,856,837 H1205L probably damaging Het
Shmt1 T C 11: 60,801,535 I132V probably damaging Het
Slc24a1 T A 9: 64,928,503 T781S unknown Het
Sncaip C T 18: 52,907,343 Q870* probably null Het
Stab1 A T 14: 31,160,797 N416K possibly damaging Het
Tcea1 A G 1: 4,867,483 D26G probably damaging Het
Tcf20 A T 15: 82,853,489 S1254T probably benign Het
Tead4 T A 6: 128,228,678 I354F probably damaging Het
Tex36 G A 7: 133,587,418 R142* probably null Het
Trav6d-3 T A 14: 52,725,342 L12Q probably damaging Het
Trpc4 A G 3: 54,194,896 T72A possibly damaging Het
Trrap G A 5: 144,797,135 A933T probably benign Het
Tspoap1 T A 11: 87,770,489 I589N probably benign Het
Ttll5 T A 12: 85,933,396 V918E probably benign Het
Txn2 A G 15: 77,927,686 probably null Het
Ucn3 T G 13: 3,941,365 T96P probably benign Het
Usp36 T C 11: 118,265,154 E764G possibly damaging Het
Vmn2r23 A T 6: 123,704,364 H77L probably benign Het
Vmn2r57 T C 7: 41,400,286 T680A probably benign Het
Vwa3a T C 7: 120,795,630 I891T possibly damaging Het
Zcchc11 T C 4: 108,527,008 Y1091H probably damaging Het
Zhx2 A G 15: 57,823,643 I803V probably benign Het
Other mutations in Klk1b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
delicato UTSW 7 44200404 splice site probably null
fragile UTSW 7 44201687 missense probably damaging 1.00
R1294:Klk1b3 UTSW 7 44200296 missense probably damaging 1.00
R4131:Klk1b3 UTSW 7 44201687 missense probably damaging 1.00
R4611:Klk1b3 UTSW 7 44201265 missense possibly damaging 0.84
R6086:Klk1b3 UTSW 7 44201734 missense probably damaging 1.00
R6631:Klk1b3 UTSW 7 44201464 missense probably benign 0.08
R6845:Klk1b3 UTSW 7 44201703 missense probably benign 0.28
R7054:Klk1b3 UTSW 7 44201439 missense probably damaging 0.99
R8816:Klk1b3 UTSW 7 44202244 missense possibly damaging 0.74
R8938:Klk1b3 UTSW 7 44200305 missense probably damaging 1.00
Z1088:Klk1b3 UTSW 7 44200305 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCAATATCTGTGCCAAACCTC -3'
(R):5'- AGTGACAGATGACCACCGAG -3'

Sequencing Primer
(F):5'- AATATCTGTGCCAAACCTCCCCTC -3'
(R):5'- CGAGACACGCAGATGTGGATTC -3'
Posted On 2019-09-06